Matches in SemOpenAlex for { <https://semopenalex.org/work/W3148831450> ?p ?o ?g. }
Showing items 1 to 92 of
92
with 100 items per page.
- W3148831450 endingPage "509" @default.
- W3148831450 startingPage "504" @default.
- W3148831450 abstract "AIM: To characterize the genetic causes and clinical features in a four-generation Chinese family with blepharophimosis-ptosis-epicanthus inversus syndrome (BPES). METHODS: Thirteen patients with BPES and eight healthy family members were included in this study. All participants received routine ophthalmic examinations. The target next-generation sequencing (NGS) was performed to determine the causative mutation for this family. The silico analysis was also applied to predict the pathogenesis of identified mutations. RESULTS: All patients had severe ptosis, normal intelligence, female patients have normal fertility. Genetic assessments revealed a heterozygous insertion variation in FOXL2 gene, c.672_701insGCGGCTGCCGC CGCAGCTGCTG CAGGCGCT (p.Ala234_Gly235linsAAAAAAAAGA), carried by 13 patient but absent in all unaffected members. In silico analysis supported the pathogenic nature of this highly conserved variant. This mutation resulted in the insertion of 10 amino acids into the encoded polyala nine chain, which increased the number of original polyalanine chains from 14 to 24, resulting in an extended protein. CONCLUSION: A novel FOXL2 mutation c.672_701ins GCGGCTGCCGCCGCAGCTGCTGC AGGCGCT (p.Ala234_Gly235linsAAAAAAAAGA) was identified in a large Chinese family with BPES. This study amplified the genotypic spectrum of FOXL2-BPES and better illustrates its genotype-phenotype correlations, which provided a basis for elucidating the pathogenesis of BPES and genetic counseling." @default.
- W3148831450 created "2021-04-13" @default.
- W3148831450 creator A5027185877 @default.
- W3148831450 creator A5039599391 @default.
- W3148831450 creator A5058122388 @default.
- W3148831450 creator A5081429148 @default.
- W3148831450 creator A5082724304 @default.
- W3148831450 date "2021-04-18" @default.
- W3148831450 modified "2023-10-01" @default.
- W3148831450 title "Identification of a novel FOXL2 mutation in a fourth-generation Chinese family with blepharophimosis-ptosis-epicanthus inversus syndrome" @default.
- W3148831450 cites W1563716212 @default.
- W3148831450 cites W1959456291 @default.
- W3148831450 cites W1978395865 @default.
- W3148831450 cites W2003831578 @default.
- W3148831450 cites W2038243028 @default.
- W3148831450 cites W2064875738 @default.
- W3148831450 cites W2101046644 @default.
- W3148831450 cites W2106381149 @default.
- W3148831450 cites W2159460939 @default.
- W3148831450 cites W2165065799 @default.
- W3148831450 cites W2520664794 @default.
- W3148831450 cites W2791333712 @default.
- W3148831450 cites W2883821260 @default.
- W3148831450 cites W2923506831 @default.
- W3148831450 cites W2943528648 @default.
- W3148831450 cites W2944236599 @default.
- W3148831450 cites W2995448419 @default.
- W3148831450 doi "https://doi.org/10.18240/ijo.2021.04.04" @default.
- W3148831450 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/8025160" @default.
- W3148831450 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/33875939" @default.
- W3148831450 hasPublicationYear "2021" @default.
- W3148831450 type Work @default.
- W3148831450 sameAs 3148831450 @default.
- W3148831450 citedByCount "1" @default.
- W3148831450 countsByYear W31488314502023 @default.
- W3148831450 crossrefType "journal-article" @default.
- W3148831450 hasAuthorship W3148831450A5027185877 @default.
- W3148831450 hasAuthorship W3148831450A5039599391 @default.
- W3148831450 hasAuthorship W3148831450A5058122388 @default.
- W3148831450 hasAuthorship W3148831450A5081429148 @default.
- W3148831450 hasAuthorship W3148831450A5082724304 @default.
- W3148831450 hasBestOaLocation W31488314501 @default.
- W3148831450 hasConcept C104317684 @default.
- W3148831450 hasConcept C118487528 @default.
- W3148831450 hasConcept C135763542 @default.
- W3148831450 hasConcept C163565370 @default.
- W3148831450 hasConcept C2775905019 @default.
- W3148831450 hasConcept C2777821979 @default.
- W3148831450 hasConcept C2781194658 @default.
- W3148831450 hasConcept C2994554639 @default.
- W3148831450 hasConcept C501734568 @default.
- W3148831450 hasConcept C54355233 @default.
- W3148831450 hasConcept C60644358 @default.
- W3148831450 hasConcept C71924100 @default.
- W3148831450 hasConcept C80227256 @default.
- W3148831450 hasConcept C86803240 @default.
- W3148831450 hasConceptScore W3148831450C104317684 @default.
- W3148831450 hasConceptScore W3148831450C118487528 @default.
- W3148831450 hasConceptScore W3148831450C135763542 @default.
- W3148831450 hasConceptScore W3148831450C163565370 @default.
- W3148831450 hasConceptScore W3148831450C2775905019 @default.
- W3148831450 hasConceptScore W3148831450C2777821979 @default.
- W3148831450 hasConceptScore W3148831450C2781194658 @default.
- W3148831450 hasConceptScore W3148831450C2994554639 @default.
- W3148831450 hasConceptScore W3148831450C501734568 @default.
- W3148831450 hasConceptScore W3148831450C54355233 @default.
- W3148831450 hasConceptScore W3148831450C60644358 @default.
- W3148831450 hasConceptScore W3148831450C71924100 @default.
- W3148831450 hasConceptScore W3148831450C80227256 @default.
- W3148831450 hasConceptScore W3148831450C86803240 @default.
- W3148831450 hasIssue "4" @default.
- W3148831450 hasLocation W31488314501 @default.
- W3148831450 hasLocation W31488314502 @default.
- W3148831450 hasOpenAccess W3148831450 @default.
- W3148831450 hasPrimaryLocation W31488314501 @default.
- W3148831450 hasRelatedWork W1964542810 @default.
- W3148831450 hasRelatedWork W1969684761 @default.
- W3148831450 hasRelatedWork W2783601274 @default.
- W3148831450 hasRelatedWork W2807260350 @default.
- W3148831450 hasRelatedWork W2969457914 @default.
- W3148831450 hasRelatedWork W2995448419 @default.
- W3148831450 hasRelatedWork W3030224010 @default.
- W3148831450 hasRelatedWork W3148831450 @default.
- W3148831450 hasRelatedWork W4205577018 @default.
- W3148831450 hasRelatedWork W71474775 @default.
- W3148831450 hasVolume "14" @default.
- W3148831450 isParatext "false" @default.
- W3148831450 isRetracted "false" @default.
- W3148831450 magId "3148831450" @default.
- W3148831450 workType "article" @default.