FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W3164010547> ?p ?o ?g. }

• W3164010547 abstract "Abstract Background Interleukin-4 (IL-4) is a multifunctional cytokine; involved in the regulation of immune responses, as well as in the pathogenicity of many diseases, such as diabetes mellitus. Some researchers suggested that IL-4 protects the human pancreatic islet from cytotoxic damages, whereas others suggested some inhibitory actions of IL-4 on pancreatic islets. This study aimed to assess the role of IL-4 genotypes of intron 3 variable number of tandem repeats of the IL-4 gene in diabetic retinopathy and diabetic neuropathy in Sudanese patients with type 2 diabetes mellitus (T2DM). This case–control study was performed in a number of Khartoum state hospitals in Sudan. The study enrolled 181 Sudanese patients, 115 (57 females and 58 males) diagnosed with T2DM and 66 (29 females and 37 males) healthy persons who served as control subjects. Polymerase chain reaction was used for the analysis of IL-4, which was amplified using the following amplification sequence (forward primer: CACGACGTTGTAAAACGACTAGGCTGAAAGGGGGAAAGC; reverse primer: CTGTTCACCTCAACTGCTCC). Biochemical analyses for highly sensitive C- reactive protein (hs-CRP), glycated hemoglobin (HbA1c), fasting plasma glucose, total cholesterol, triglycerides, low-density lipoprotein, and high-density lipoprotein were performed using a chemical analyzer. Results The study showed that in the diabetic group, 49(42.6%) had diabetic retinopathy, whereas 7(6.1%) had diabetic neuropathy. The B1B1 genotype was found to be a higher risk factor for developing diabetic retinopathy than B2B2 [P = 0.028; Odds ratio (OR) = 1.381; 95% confidence interval (CI) 1.344–9.062], whereas the B1B2 genotype was found to be insignificantly associated with retinopathy (P = 0.357; OR = 1.570; 95% CI 0.654–3.887). Furthermore, hs-CRP and HbA1c were significantly increased in diabetic neuropathy with IL-4 B1B1 genotype. Conclusions IL-4 gene polymorphisms can be good markers for the early identification of risk for diabetic retinopathy and neuropathy in Sudanese people. The hs-CRP and HbA1c in diabetic patients with IL-4 B1B1 genotype may be predisposition predictors of diabetic neuropathy." @default.
• W3164010547 created "2021-06-07" @default.
• W3164010547 creator A5017655980 @default.
• W3164010547 creator A5042519089 @default.
• W3164010547 creator A5047509966 @default.
• W3164010547 creator A5062444223 @default.
• W3164010547 creator A5085416765 @default.
• W3164010547 date "2021-05-25" @default.
• W3164010547 modified "2023-10-18" @default.
• W3164010547 title "Association of interleukin-4 polymorphism with diabetic retinopathy and neuropathy in a Sudanese population" @default.
• W3164010547 cites W1579713291 @default.
• W3164010547 cites W1704792035 @default.
• W3164010547 cites W1979185358 @default.
• W3164010547 cites W1983353174 @default.
• W3164010547 cites W2000220102 @default.
• W3164010547 cites W2004790759 @default.
• W3164010547 cites W2016795705 @default.
• W3164010547 cites W2043046650 @default.
• W3164010547 cites W2043503204 @default.
• W3164010547 cites W2051538586 @default.
• W3164010547 cites W2081535097 @default.
• W3164010547 cites W2167543749 @default.
• W3164010547 cites W2313130293 @default.
• W3164010547 cites W2323275321 @default.
• W3164010547 cites W2412318883 @default.
• W3164010547 cites W2560049155 @default.
• W3164010547 cites W2565540700 @default.
• W3164010547 cites W2591591136 @default.
• W3164010547 cites W2790451379 @default.
• W3164010547 cites W2793048811 @default.
• W3164010547 cites W2800640877 @default.
• W3164010547 cites W2937096955 @default.
• W3164010547 cites W2976212737 @default.
• W3164010547 cites W2977727921 @default.
• W3164010547 cites W2981686375 @default.
• W3164010547 cites W3005211134 @default.
• W3164010547 cites W3046395901 @default.
• W3164010547 doi "https://doi.org/10.1186/s42269-021-00555-5" @default.
• W3164010547 hasPublicationYear "2021" @default.
• W3164010547 type Work @default.
• W3164010547 sameAs 3164010547 @default.
• W3164010547 citedByCount "0" @default.
• W3164010547 crossrefType "journal-article" @default.
• W3164010547 hasAuthorship W3164010547A5017655980 @default.
• W3164010547 hasAuthorship W3164010547A5042519089 @default.
• W3164010547 hasAuthorship W3164010547A5047509966 @default.
• W3164010547 hasAuthorship W3164010547A5062444223 @default.
• W3164010547 hasAuthorship W3164010547A5085416765 @default.
• W3164010547 hasBestOaLocation W31640105471 @default.
• W3164010547 hasConcept C104317684 @default.
• W3164010547 hasConcept C126322002 @default.
• W3164010547 hasConcept C134018914 @default.
• W3164010547 hasConcept C135763542 @default.
• W3164010547 hasConcept C156957248 @default.
• W3164010547 hasConcept C203014093 @default.
• W3164010547 hasConcept C2777180221 @default.
• W3164010547 hasConcept C2777538456 @default.
• W3164010547 hasConcept C2778313320 @default.
• W3164010547 hasConcept C2779829184 @default.
• W3164010547 hasConcept C54355233 @default.
• W3164010547 hasConcept C555293320 @default.
• W3164010547 hasConcept C71924100 @default.
• W3164010547 hasConcept C86803240 @default.
• W3164010547 hasConcept C90924648 @default.
• W3164010547 hasConceptScore W3164010547C104317684 @default.
• W3164010547 hasConceptScore W3164010547C126322002 @default.
• W3164010547 hasConceptScore W3164010547C134018914 @default.
• W3164010547 hasConceptScore W3164010547C135763542 @default.
• W3164010547 hasConceptScore W3164010547C156957248 @default.
• W3164010547 hasConceptScore W3164010547C203014093 @default.
• W3164010547 hasConceptScore W3164010547C2777180221 @default.
• W3164010547 hasConceptScore W3164010547C2777538456 @default.
• W3164010547 hasConceptScore W3164010547C2778313320 @default.
• W3164010547 hasConceptScore W3164010547C2779829184 @default.
• W3164010547 hasConceptScore W3164010547C54355233 @default.
• W3164010547 hasConceptScore W3164010547C555293320 @default.
• W3164010547 hasConceptScore W3164010547C71924100 @default.
• W3164010547 hasConceptScore W3164010547C86803240 @default.
• W3164010547 hasConceptScore W3164010547C90924648 @default.
• W3164010547 hasIssue "1" @default.
• W3164010547 hasLocation W31640105471 @default.
• W3164010547 hasOpenAccess W3164010547 @default.
• W3164010547 hasPrimaryLocation W31640105471 @default.
• W3164010547 hasRelatedWork W1531257033 @default.
• W3164010547 hasRelatedWork W1972498396 @default.
• W3164010547 hasRelatedWork W2039962271 @default.
• W3164010547 hasRelatedWork W2342880967 @default.
• W3164010547 hasRelatedWork W2371200445 @default.
• W3164010547 hasRelatedWork W2389336858 @default.
• W3164010547 hasRelatedWork W2997798583 @default.
• W3164010547 hasRelatedWork W3009470800 @default.
• W3164010547 hasRelatedWork W3038868211 @default.
• W3164010547 hasRelatedWork W3176696452 @default.
• W3164010547 hasVolume "45" @default.
• W3164010547 isParatext "false" @default.
• W3164010547 isRetracted "false" @default.
• W3164010547 magId "3164010547" @default.
• W3164010547 workType "article" @default.