Matches in SemOpenAlex for { <https://semopenalex.org/work/W3167133063> ?p ?o ?g. }
- W3167133063 endingPage "12125" @default.
- W3167133063 startingPage "12115" @default.
- W3167133063 abstract "Abstract Guanine quadruplexes (G4s) are noncanonical forms of nucleic acids that are frequently found in genomes. The stability of G4s depends, among other factors, on the number of G‐tetrads. Three‐ or four‐tetrad G4s and antiparallel two‐tetrad G4s have been characterized experimentally; however, the existence of an intramolecular (i. e., not dimeric or multimeric) two‐tetrad parallel‐stranded DNA G4 has never been experimentally observed. Many sequences compatible with two‐tetrad G4 can be found in important genomic regions, such as promoters, for which parallel G4s predominate. Using experimental and theoretical approaches, the propensity of the model sequence AATGGGTGGGTTTGGGTGGGTAA to form an intramolecular parallel‐stranded G4 upon increasing the number of GGG‐to‐GG substitutions has been studied. Deletion of a single G leads to the formation of intramolecular G4s with a stacked G‐triad, whose topology depends on the location of the deletion. Removal of another guanine from another G‐tract leads to di‐ or multimeric G4s. Further deletions mostly prevent the formation of any stable G4. Thus, a solitary two‐tetrad parallel DNA G4 is not thermodynamically stable and requires additional interactions through capping residues. However, transiently populated metastable two‐tetrad species can associate to form stable dimers, the dynamic formation of which might play additional delicate roles in gene regulation. These findings provide essential information for bioinformatics studies searching for potential G4s in genomes." @default.
- W3167133063 created "2021-06-22" @default.
- W3167133063 creator A5002809217 @default.
- W3167133063 creator A5026399646 @default.
- W3167133063 creator A5028187203 @default.
- W3167133063 creator A5032951425 @default.
- W3167133063 creator A5056575702 @default.
- W3167133063 creator A5069555359 @default.
- W3167133063 creator A5079122410 @default.
- W3167133063 creator A5080984119 @default.
- W3167133063 creator A5081021433 @default.
- W3167133063 creator A5090321403 @default.
- W3167133063 creator A5091346274 @default.
- W3167133063 date "2021-07-20" @default.
- W3167133063 modified "2023-10-16" @default.
- W3167133063 title "G‐Quadruplex Formation by DNA Sequences Deficient in Guanines: Two Tetrad Parallel Quadruplexes Do Not Fold Intramolecularly" @default.
- W3167133063 cites W1526862990 @default.
- W3167133063 cites W1784617990 @default.
- W3167133063 cites W1887262817 @default.
- W3167133063 cites W1914649288 @default.
- W3167133063 cites W1969189143 @default.
- W3167133063 cites W1974568730 @default.
- W3167133063 cites W1978685619 @default.
- W3167133063 cites W1978830897 @default.
- W3167133063 cites W1980595949 @default.
- W3167133063 cites W1981225934 @default.
- W3167133063 cites W1981888951 @default.
- W3167133063 cites W1997586605 @default.
- W3167133063 cites W2002025936 @default.
- W3167133063 cites W2007812774 @default.
- W3167133063 cites W2008120871 @default.
- W3167133063 cites W2015642465 @default.
- W3167133063 cites W2035266068 @default.
- W3167133063 cites W2035687084 @default.
- W3167133063 cites W2038304204 @default.
- W3167133063 cites W2049475242 @default.
- W3167133063 cites W2053586924 @default.
- W3167133063 cites W2059113504 @default.
- W3167133063 cites W2059305343 @default.
- W3167133063 cites W2062724831 @default.
- W3167133063 cites W2079768304 @default.
- W3167133063 cites W2082168427 @default.
- W3167133063 cites W2083276919 @default.
- W3167133063 cites W2086181830 @default.
- W3167133063 cites W2088456802 @default.
- W3167133063 cites W2089619525 @default.
- W3167133063 cites W2101767012 @default.
- W3167133063 cites W2103945336 @default.
- W3167133063 cites W2106140689 @default.
- W3167133063 cites W2108843451 @default.
- W3167133063 cites W2110745457 @default.
- W3167133063 cites W2122199548 @default.
- W3167133063 cites W2132070326 @default.
- W3167133063 cites W2136729627 @default.
- W3167133063 cites W2137500638 @default.
- W3167133063 cites W2144100895 @default.
- W3167133063 cites W2155773930 @default.
- W3167133063 cites W2158737337 @default.
- W3167133063 cites W2163661389 @default.
- W3167133063 cites W2166965022 @default.
- W3167133063 cites W2168839470 @default.
- W3167133063 cites W2172060739 @default.
- W3167133063 cites W2229724153 @default.
- W3167133063 cites W2313116527 @default.
- W3167133063 cites W2331682169 @default.
- W3167133063 cites W2344252179 @default.
- W3167133063 cites W2561564177 @default.
- W3167133063 cites W2590327834 @default.
- W3167133063 cites W2602287294 @default.
- W3167133063 cites W2617272526 @default.
- W3167133063 cites W2892147033 @default.
- W3167133063 cites W2902814834 @default.
- W3167133063 cites W2906248005 @default.
- W3167133063 cites W2907011108 @default.
- W3167133063 cites W2935905363 @default.
- W3167133063 cites W2951831607 @default.
- W3167133063 cites W2971006550 @default.
- W3167133063 cites W2974326846 @default.
- W3167133063 cites W3006884793 @default.
- W3167133063 cites W3008024543 @default.
- W3167133063 cites W3011888654 @default.
- W3167133063 cites W3043765262 @default.
- W3167133063 cites W3081206237 @default.
- W3167133063 cites W4230552606 @default.
- W3167133063 cites W4238290049 @default.
- W3167133063 cites W4250815001 @default.
- W3167133063 doi "https://doi.org/10.1002/chem.202100895" @default.
- W3167133063 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/34145655" @default.
- W3167133063 hasPublicationYear "2021" @default.
- W3167133063 type Work @default.
- W3167133063 sameAs 3167133063 @default.
- W3167133063 citedByCount "11" @default.
- W3167133063 countsByYear W31671330632021 @default.
- W3167133063 countsByYear W31671330632022 @default.
- W3167133063 countsByYear W31671330632023 @default.
- W3167133063 crossrefType "journal-article" @default.
- W3167133063 hasAuthorship W3167133063A5002809217 @default.
- W3167133063 hasAuthorship W3167133063A5026399646 @default.