Matches in SemOpenAlex for { <https://semopenalex.org/work/W3214979413> ?p ?o ?g. }
Showing items 1 to 64 of
64
with 100 items per page.
- W3214979413 abstract "Corrigendum: Crawling Motility on the Host Tissue Surfaces Is Associated With the Pathogenicity of the Zoonotic Spirochete LeptospiraJun Xu1, Nobuo Koizumi2 and Shuichi Nakamura31Department of Animal Microbiology, Graduate School of Agricultural Science, Tohoku University, Sendai, Japan, 2Department of Bacteriology I, National Institute of Infectious Diseases, Tokyo, Japan, 3Department of Applied Physics, Graduate School of Engineering, Tohoku University, Sendai, Japan* Correspondence: naka@bp.apph.tohoku.ac.jpKeywords: bacterial motility, pathogenicity, spirochete, leptospirosis, zoonosis, host–pathogen association, biophysics, optical microscopy.Corrigendum on: Supplementary Table S1 Error in Figure/TableIn the original article, there was a mistake in Supplementary Table S1. Primer sequences used in this study as published. In the original version, “TATCGATACCGTCGATCACTTGTACAGCTCATCCATG” is shown as the reverse primer of AcGFP, but “GCTGGCCGGCGTCGATCACTTGTACAGCTCATCCATG” is correct. The corrected Supplementary Table S1 appears below.The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way." @default.
- W3214979413 created "2021-12-06" @default.
- W3214979413 creator A5006737880 @default.
- W3214979413 creator A5009919972 @default.
- W3214979413 creator A5088842005 @default.
- W3214979413 date "2021-08-17" @default.
- W3214979413 modified "2023-09-26" @default.
- W3214979413 title "Corrigendum: Crawling Motility on the Host Tissue Surfaces Is Associated With the Pathogenicity of the Zoonotic Spirochete Leptospira" @default.
- W3214979413 doi "https://doi.org/10.3389/fmicb.2021.736406" @default.
- W3214979413 hasPublicationYear "2021" @default.
- W3214979413 type Work @default.
- W3214979413 sameAs 3214979413 @default.
- W3214979413 citedByCount "0" @default.
- W3214979413 crossrefType "journal-article" @default.
- W3214979413 hasAuthorship W3214979413A5006737880 @default.
- W3214979413 hasAuthorship W3214979413A5009919972 @default.
- W3214979413 hasAuthorship W3214979413A5088842005 @default.
- W3214979413 hasBestOaLocation W32149794131 @default.
- W3214979413 hasConcept C124101348 @default.
- W3214979413 hasConcept C126831891 @default.
- W3214979413 hasConcept C159047783 @default.
- W3214979413 hasConcept C2776353676 @default.
- W3214979413 hasConcept C2776460866 @default.
- W3214979413 hasConcept C2778033228 @default.
- W3214979413 hasConcept C2780542935 @default.
- W3214979413 hasConcept C41008148 @default.
- W3214979413 hasConcept C45235069 @default.
- W3214979413 hasConcept C54355233 @default.
- W3214979413 hasConcept C64502627 @default.
- W3214979413 hasConcept C86803240 @default.
- W3214979413 hasConcept C89423630 @default.
- W3214979413 hasConceptScore W3214979413C124101348 @default.
- W3214979413 hasConceptScore W3214979413C126831891 @default.
- W3214979413 hasConceptScore W3214979413C159047783 @default.
- W3214979413 hasConceptScore W3214979413C2776353676 @default.
- W3214979413 hasConceptScore W3214979413C2776460866 @default.
- W3214979413 hasConceptScore W3214979413C2778033228 @default.
- W3214979413 hasConceptScore W3214979413C2780542935 @default.
- W3214979413 hasConceptScore W3214979413C41008148 @default.
- W3214979413 hasConceptScore W3214979413C45235069 @default.
- W3214979413 hasConceptScore W3214979413C54355233 @default.
- W3214979413 hasConceptScore W3214979413C64502627 @default.
- W3214979413 hasConceptScore W3214979413C86803240 @default.
- W3214979413 hasConceptScore W3214979413C89423630 @default.
- W3214979413 hasLocation W32149794131 @default.
- W3214979413 hasLocation W32149794132 @default.
- W3214979413 hasLocation W32149794133 @default.
- W3214979413 hasOpenAccess W3214979413 @default.
- W3214979413 hasPrimaryLocation W32149794131 @default.
- W3214979413 hasRelatedWork W2140396931 @default.
- W3214979413 hasRelatedWork W2163186636 @default.
- W3214979413 hasRelatedWork W2235018391 @default.
- W3214979413 hasRelatedWork W2588856951 @default.
- W3214979413 hasRelatedWork W2951148519 @default.
- W3214979413 hasRelatedWork W3049473768 @default.
- W3214979413 hasRelatedWork W3214979413 @default.
- W3214979413 hasRelatedWork W4210772152 @default.
- W3214979413 hasRelatedWork W4282823806 @default.
- W3214979413 hasRelatedWork W2585030557 @default.
- W3214979413 hasVolume "12" @default.
- W3214979413 isParatext "false" @default.
- W3214979413 isRetracted "false" @default.
- W3214979413 magId "3214979413" @default.
- W3214979413 workType "article" @default.