FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W4234309683> ?p ?o ?g. }

• W4234309683 endingPage "160" @default.
• W4234309683 startingPage "157" @default.
• W4234309683 abstract "EPPO BulletinVolume 36, Issue 1 p. 157-160 DiagnosticsFree Access American plum line pattern ilarvirus First published: 30 June 2006 https://doi.org/10.1111/j.1365-2338.2006.00928.xCitations: 1 European and Mediterranean Plant Protection Organisation PM 7/67 (1) Organisation Européenne et Méditerranéenne pour la Protection des Plantes AboutSectionsPDF ToolsRequest permissionExport citationAdd to favoritesTrack citation ShareShare Give accessShare full text accessShare full-text accessPlease review our Terms and Conditions of Use and check box below to share full-text version of article.I have read and accept the Wiley Online Library Terms and Conditions of UseShareable LinkUse the link below to share a full-text version of this article with your friends and colleagues. Learn more.Copy URL Share a linkShare onFacebookTwitterLinkedInRedditWechat Specific scope This standard describes a diagnostic protocol for American plum line pattern ilarvirus. Specific approval and amendment Approved in 2005-09. Introduction American plum line pattern virus (APLPV) is the least extensively documented Ilarvirus reported to infect stone fruits. The virus infects stone fruits, in particular, Japanese plum, peach and flowering cherry, causing generally clear-cut symptoms. Sap and grafting transmission of the virus was reported early (Kirkpatrick et al., 1964; Paulsen & Fulton, 1968; Fulton, 1984). Detection by ELISA was described by Fulton (1982). Scott & Zimmerman (2001) reported the full genomic sequence of a Northern American isolate of APLPV and its detection by molecular hybridization and RT-PCR. Additional information on APLPV detection was also reported by Alayasa et al. (2003) and Al Rwahnih et al. (2004). Recently, simultaneous detection by one-step RT-PCR of eight stone-fruit viruses, including APLPV, was set up by Sánchez-Navarro et al., 2005). APLPV is a positive-sense RNA virus with a tripartite genome. It has four types of quasi-isometric particles, 26, 28, 31 and 33 nm in diameter. The virus is known to be transmitted only by propagating material. Several APLPV isolates of Mediterranean origin have been sequenced and comparative analysis revealed low genetic diversity among their coat and movement proteins, as well as with the proteins of American isolates (Myrta et al., 2002; Herranz et al., 2003). Identity Name: American plum line pattern ilarvirus Synonyms: plum line pattern virus, peach line pattern virosis virus, Plum American line pattern virus, prunus virus 10 Acronym: APLPV Taxonomic position: Viruses, Bromoviridae, Ilarvirus EPPO code: APLPV0 Phytosanitary categorization: EPPO A1 list n°28, EU Annex: I/A1 – as Plum line pattern virus (American) Detection Stone-fruit trees infected by APLPV generally show striking symptoms which vary seasonally, so visual inspection has practical importance. However, similar symptoms on Prunus spp. may also be caused by other ilarviruses, e.g. Apple mosaic ilarvirus (ApMV) and Prunus necrotic ringspot ilarvirus (PNRSV). Moreover, some host cultivars do not show overt symptoms. So laboratory tests are required for unequivocal identification of the virus. Disease symptoms On Japanese plum, there is a regular sequence of pattern types, starting with chlorotic ring (Web Fig. 1a) and oak-leaf type pattern (Web Fig. 1b) and finally yellow vein banding. In the early summer, the yellow pattern fades to a creamy-white one (Web Fig. 1c). In other cases, leaf borders are first chlorotic and then turn golden (Web Fig. 2). The symptoms do not disappear during the hot season, but new leaves emerging during this period are symptomless. On peach, in spring and early summer, there are fine irregular, pale-green, wavy bands on each side of the main veins of the leaves. These either form a symmetrical pattern or are broken and turned back to form figures of various shapes. Some leaves develop a network of fine lines, or a golden net pattern, fine confluent rings, vein banding, or an oak-leaf pattern. Symptoms usually disappear in summer. On P. serrulata, whitish, yellowish or pinkish discoloured areas of various forms occur, sometimes large rings but more often oak-leaf pattern. Leaf borders are faintly chlorotic to pronounced golden or white. Identification Sampling In spring, leaves are a better virus source than flowers and cortical tissues, whereas in summer, mature fruits are better than leaves. Dormant buds represent a reliable tissue source for testing in winter. If typical symptoms are present in leaves, symptomatic leaves should be collected. If the tree is symptomless, leaves should be collected from different parts of the canopy. When sampling is done in spring, the location of leaves on one-year branches seems not to have any effect in virus detection. During the hot season, basal mature leaves are a slightly better source than those of central and apical positions. Leaf samples, as for the other stone fruit ilarviruses, can be stored at 4°C for not more than 7 days before processing. Sample preparation Sample preparation is intended for serological or molecular testing. Approximately 0.5 g of plant material is weighed, cut into small peaces and placed in a plastic bag or mortar for processing. Processing is done manually or with different equipment: for details, see EPPO Standard PM 7/32 (1). Elisa Approximately 20 volumes of extraction buffer are added and the sample is homogenized. The composition of extraction buffer used is in Appendix 1b. The extracted sample is ready to be loaded. Molecular testing Approximately 10 volumes of extraction buffer (Appendix 1d) are added and the sample is homogenized. 50 µL of 20% SDS is added to 1 mL of the homogenate and incubated at 65°C for 20 min. Then 0.25 mL of 5 m potassium acetate added and incubated at 0°C (ice bath) for 20 min. The samples are centrifuged at 12 000 rev min-1 for 15 min, the supernatant is allowed to precipitate with ethanol and resuspended in 40 µL of sterile H2O. For dot-blot hybridization, 5 µL of each acid nucleic preparation is denatured by adding 3 µL of 20X SSC and 37% formaldehyde (10 min at 65°C). Finally, aliquots of the samples are dotted onto positively charged nylon membranes and fixed by UV cross-linking. Membranes can be kept for several years in a dry place, before being developed by molecular hybridization. For RT-PCR, 0.5 µL of total nucleic acids is used. Testing on woody indicators The virus can be detected by grafting onto suitable woody indicators. Glasshouse testing is recommended on GF305 at 20°C for about 3 months. Field testing on Shiro plum requires about 2 years (ISHS, 1998). GF305 displays generally faint chlorotic patterns (Web Fig. 3), whereas Shiro gives a reaction ranging from a thin reticulation to the classical line pattern. Several European plum cultivars (e.g. ‘President’, ‘Regina Claudia verde’, ‘Blue Free’) may also be good indicators (Web Fig. 4) for APLPV in glasshouse conditions (Alayasa et al., 2003). Testing on woody indicators is extremely slow and would only be appropriate if such testing was also being done for other viruses. In any case, final identification requires serological or molecular tests. Testing on herbaceous indicators APLPV can be sap-transmitted to numerous herbaceous species, but many of them remain latently infected. Herbaceous plants should be observed for 2–3 weeks in a temperature-controlled glasshouse at 20°C. The indicators to be used are Nicotiana occidentalis, Chenopodium amaranticolor, Vigna unguiculata. N. occidentalis develop chlorotic blotching and necrotic ringspots (Web Fig. 5); C. amaranticolor, chlorotic spots, leaf deformation and apical stunting (Web Fig. 6); and Vigna unguiculata, leaf deformation. This method alone is not reliable for virus detection, but it can be used as a complementary test or when similar testing is being done for several viruses. In any case, final identification requires serological or molecular tests. Serological tests APLPV is not serologically related to any of the other ilarviruses that affect stone-fruit trees. DAS-ELISA (Double Antibody Sandwich ELISA) is performed according to Clark & Adams (1977), using the protocol described in Appendix 2 and materials described in Appendix 1a. ELISA is a reliable and rapid method, requiring relatively simple equipment and only short training. However, a commercially available ELISA kit has some reaction to healthy plant tissue. To overcome this problem, see details in Appendix 1b. Molecular tests Dot blot hybridization Dot blot hybridization is performed according to Pallás et al. (1998), using the detailed protocol described in Appendix 3 and materials described in Appendix 1c and 1d. The synthesis of the digoxigenin-labelled riboprobe is performed according to Más et al. (1993) and Pallás et al. (1998), using the detailed protocol described in Appendix 3. Three different riboprobes have been developed so far to detect APLPV (Scott & Zimmerman, 2001; Alayasa et al., 2003; Sánchez-Navarro et al., 2005). Only in one case (riboprobe pCP-APLPV; Sanchez-Navarro et al., 2005) has the sensitivity limit been analysed by using serial dilutions of infected tissue. None of the three riboprobes cross-hybridized with other ilarviruses (ApMV, Prune dwarf ilarvirus, PNRSV). Molecular hybridization is more reliable than ELISA, especially in testing during the nonoptimal detection season (Al Rwahnih et al., 2004), and therefore it can be considered as a satisfactory alternative for routine diagnosis. RT-PCR RT-PCR is performed according to Sánchez-Navarro et al. (2005) or Scott & Zimmerman (2001) using the detailed protocol described in Appendix 3 and material described in Appendix 1c. The amplified product consists of 563 bp or 123 bp, respectively. Primers described by Sánchez-Navarro et al., 2005) amplify up to 8 different APLPV isolates from different geographical origin, validating their wide-range use. The detection limit of APLPV is slightly affected in the simultaneous RT-PCR for eight viruses of stone fruit trees, by comparison with the single test (Sánchez-Navarro et al., 2005). Reporting and documentation Guidelines on reporting and documentation are given in EPPO Standard PM7/– (in preparation). Further information Further information on this organism can be obtained from: Istituto Agronomico Mediterraneo, Via Ceglie 9, 70010 Valenzano, Bari (IT); E-mail: myrta@iamb.it Istituto de Biologia Molecular y Celular de Plantas, Universidad Politecnica de Valencia-CSIC, Avenida de los Naranjos s/n 46022 Valencia (ES); E-mail:vpallas@ibmcp.upv.es. Footnotes 1 The figures in this Standard marked ‘Web Fig.’ are published on the EPPO website http://www.eppo.org. Acknowledgements This protocol was originally drafted by A. Myrta, Istituto Agronomico Mediterraneo, Valenzano (IT) and V. Pallás, Universidad Politecnica de Valencia (ES). Appendices Appendix 1 Materials Materials for detection of APLPV in plant tissues by serological tests Standard APLPV-infected and healthy controls are commercially available. ELISA buffers For ELISA buffers, see EPPO Standard PM 7/32 (1). If some unspecific reaction is obtained to healthy plant tissue using conventional extraction buffer, it should be extracted with the following buffer, at a ratio of 1 : 100 (weight:volume): bovine serum albumin (BSA) 2 g, polyvinylpyrrolidone (PVP) MW 24-40 000 20 g, sodium azide 0.2 g, PBS-Tween 1 × 1 L, pH 7.2–7.4. Materials for detection of APLPV in plant tissues by molecular tests APLPV probes are available for nonprofit institutions at Instituto de Biologia Molecular y Celular de Plantas, Universidad Politecnica de Valencia-CSIC, Avenida de los Naranjos s/n 46022 Valencia (SP). One step RT-PCR Oligonucleotide primer sequences (Sánchez-Navarro et al., 2005): VP 340 (sense) 5′-3′ GGTCGTCAAGGGAGAGGC (nt1490-1508) VP 339 (antisense) 5′-3′ GGCCCCTAAGGGTCATTTC (nt 2034-53) Oligonucleotide primer sequences (Scott & Zimmerman, 2001): (sense) 5′-3′ GATATTGCTGCCTCACAAGTGG (nt1663-1684) (antisense) 5′-3′ CCTCGAGAAATTTCTCGAGATGG (nt1562-1584) Molecular hybridization pAPLPV-385 dig-riboprobe: (126-510 nt RNA 3) as described by Alayasa et al. (2003). pCP-APLPV: (1490-2053 nt RNA 3) as described by Sánchez-Navarro et al., 2005). Buffers for molecular tests Extraction buffer: 100 mm Tris-HCl pH 8.0, 50 mm EDTA pH 7.0, 500 mm NaCl, 10 mmβ-mercaptoethanol. Pre-hybridization solution: 50% formamide, SSC 5X, 0.1% N-Lauroylsarcosine, 0.02% SDS and blocking 10X. Buffer 1: 0.1 m Maleic acid, 0.15 m NaCl, ajust pH 7.5 with NaOH. Blocking buffer: Buffer 1, blocking agent 1 X (ROCHE 1 096 176). Buffer 3: 1 m Tris-HCl pH 9.5, 0.1 m NaCl. Appendix 2 Detailed protocols for serological tests DAS-ELISA (Clark & Adams, 1977) to be performed as described in EPPO Standard PM 7/32 (1). Positive controls (infected plant material, preferably hosts of the same species as the test plants where available) and negative controls (healthy plant material and buffer) should be included, if possible. The ELISA value of the sample should be at least twice than that of the negative control. Appendix 3 Detailed protocols for molecular tests Synthesis of digoxygenin-labelled riboprobes Linearize 1 µg of pAPLPV385 (Alayasa et al., 2003) or pCP-APLPV (Sánchez-Navarro et al., 2005) both containing a partial sequence of the RNA 3 with SacI and NcoI, or make blunt end with T4 DNA polymerase, purify with phenol:chloroform, precipitate with ethanol, and resuspend in sterile water. Synthesize dig-riboprobe with T7 RNA polymerase (Alayasa et al., 2003) and SP6 RNA polymerase (Sánchez-Navarro et al., 2005), as described by Más et al. (1993). Transcription reaction (20 µL): 1 µg of linearized plasmid, 2 µL of 10x transcription buffer, 40 U of T7/SP6 RNA polymerase (ROCHE 881 767), 20 U RNase inhibitor (Amersham pharmacia biotech E 2310Y), 2 µL 10X DIG RNA Labeling Mix (Roche 1 277 073). Incubate 2 h at 37°C. Molecular hybridization Incubate the membranes at 68°C at least 1 h in the prehybridization solution (Appendix 1). Prepare the hybridization solution using 50–100 ng of riboprobe previously denatured (10 min at 65°C) per mL of prehybridization solution and incubate the membrane at least 4–6 h (up to overnight). After hybridization, wash first 2 × 5 min in SSC 2X containing 0.1% SDS at room temperature and then 2 × 15 min in SSC 0.1X containing 0.1% SDS at 68°C. The rest of the steps are carried out at room temperature. Wash 2 × 5 min with Buffer 1 containing 0.3% Tween 20 (Sigma P-1379). Block the membrane with the blocking buffer for 30 min and incubate with Anti-Digoxigenin-AP Fab fragments (Roche 1 093 274) diluted 1 : 10 000 in blocking buffer. Wash membrane 2 × 15 min in Buffer 1 containing 0.3% Tween 20 and then with Buffer 3 during 5 min. Place the membranes in a plastic bag with a chemiluminiscent substrate (CSPD diluted 1 : 100 in Buffer 3, Roche 1 655 884) during 5 min in darkness. Eliminate CSPD excess without totally drying the membrane. Expose the films for 10–60 min. Amplification by RT-PCR APLPV detection VP 340-VP 339 primers described by Sánchez-Navarro et al. (2005): VP 340 (sense) 5′-3′ GGTCGTCAAGGGAGAGGC VP 339 (antisense) 5′-3′ GGCCCCTAAGGGTCATTTC One-step RT-PCR reaction: 0.4 µL SuperScript III one-step RT-PCR (Platinum Taq DNA polymerase kit, Invitrogen), 5 µL 2X SuperScript III buffer, 0.1 µL primer VP 340 (0.75 pmol), 0.1 µL primer VP 339 (0.75 pmol), 0.5 µL total nucleic acids, 3.9 µL of H2O. Conditions for one-step RT-PCR: 50°C for 30 min; 2 min at 94°C; 40 cycles of denaturation at 94°C for 15 s, 50 °C for 30 s, 68°C for 1 min; finally 68°C for 7 min. APLPV detection by primers described by Scott and Zimmerman (2001): (sense) 5′-3′ GATATTGCTGCCTCACAAGTGG (antisense) 5′-3′ CCTCGAGAAATTTCTCGAGATGG Conditions for RT-PCR: 1 cycle of 94°C for 3 min; 35 cycles of denaturation at 94°C for 30 s, 60°C for 30 s, 72°C for 2 min Electrophoresis of PCR products To be performed as in EPPO Standard PM 7/32 (1). References Al Rwahnih M, Myrta A, Herranz MC & Pallás V (2004) Tracking American plum line pattern virus in plum by ELISA and dot-blot hybridisation during a whole year. Journal of Plant Pathology 86, 167– 169. Alayasa N, Al Rwahnih M, Myrta A, Herranz MC, Minafra A, Boscia D, Castellano MA & Pallás V (2003) Identification and characterization of an American plum line pattern virus (APLPV) isolate from Palestine. Journal of Plant Pathology 85, 3– 7. Clark MF & Adams AN (1977) Characteristics of the microplate method of enzyme-linked immunosorbent assay for the detection of plant viruses. Journal of General Virology 34, 475– 483. Fulton RW (1982) Ilar-like characteristics of American plum line pattern virus and its serological detection in Prunus. Phytopathology 72, 1345– 1348. Fulton RW (1984) American plum line pattern virus. CMI/AAB Descriptions of Plant Viruses no. 280. AAB, Wellesbourne (GB). Herranz MC, Alayasa N, Al Rwahnih M, Myrta A, Minafra A, Boscia D & Pallás V (2003) The coat proteins of isolates of American plum line pattern virus from different origins show very low genetic diversity. 19th International Symposium on Virus and Virus-Like Diseases of Temperate Fruit Crops, P. 29. Valencia (ES). ISHS (1998) Detection of virus and virus-like diseases of fruit trees. Acta Horticulturae no. 472, 761– 783. Kirkpatrick HC, Cheney PW & Linder RC (1964) Mechanical transmission of plum line pattern virus. Plant Disease Reporter 48, 616– 618. Más P, Sánchez-Navarro JA, Sánchez-Pina MA & Pallás V (1993) Chemiluminescent and colorigenic detection of cherry leaf roll virus with digoxigenin-labelled RNA probes. Journal of Virological Methods 45, 93– 102. Myrta A, Abbadi H, Herranz MC, Al Rwahnih M, Di Terlizzi B, Minafra A & Pallás V (2002) First report of American plum line pattern virus (APLPV) in Albania, Italy and Tunisia. Journal of Plant Pathology 84, 188 (Abstract). Németh M (1986) Virus, Mycoplasma and Rickettsia Diseases of Fruit Trees. Martinus-Nijhoff, Dordrecht (NL). Pallás V, Sanchez-Navarro JA, Mas P, Cañizares MC, Aparicio F & Marcos JF (1998) Molecular diagnostic techniques and their potential role in stone fruit certification schemes. In: Options Méditerranéennes, Série B/ No. 19, Stone Fruit Viruses and Certification in the Mediterranean Countries: Problems and Prospects (Ed. B Di Terlizzi, A Myrta & V Savino), pp. 191– 208. CIHEAM/IAMB, Bari (IT). Paulsen AQ & Fulton RW (1968) Hosts and properties of a plum line pattern virus. Phytopathology 58, 766– 772. Sánchez-Navarro JA, Aparicio F, Herranz MC, Minafra A, Myrta A & Pallás V (2005) Simultaneous detection and identification of eight stone fruit viruses by one step RT-PCR. European Journal of Plant Pathology 111, 77– 84. Scott SW & Zimmerman MT (2001) American plum line pattern is a distinct ilarvirus. Acta Horticulturae no. 550, 221– 228. Citing Literature Volume36, Issue1April 2006Pages 157-160 ReferencesRelatedInformation" @default.
• W4234309683 created "2022-05-12" @default.
• W4234309683 date "2006-04-01" @default.
• W4234309683 modified "2023-10-15" @default.
• W4234309683 title "American plum line pattern ilarvirus" @default.
• W4234309683 cites W1187932265 @default.
• W4234309683 cites W1968327599 @default.
• W4234309683 cites W1972934647 @default.
• W4234309683 cites W2023848013 @default.
• W4234309683 cites W2148546257 @default.
• W4234309683 doi "https://doi.org/10.1111/j.1365-2338.2006.00928.x" @default.
• W4234309683 hasPublicationYear "2006" @default.
• W4234309683 type Work @default.
• W4234309683 citedByCount "1" @default.
• W4234309683 countsByYear W42343096832015 @default.
• W4234309683 crossrefType "journal-article" @default.
• W4234309683 hasConcept C198352243 @default.
• W4234309683 hasConcept C205649164 @default.
• W4234309683 hasConcept C2524010 @default.
• W4234309683 hasConcept C33923547 @default.
• W4234309683 hasConcept C86803240 @default.
• W4234309683 hasConceptScore W4234309683C198352243 @default.
• W4234309683 hasConceptScore W4234309683C205649164 @default.
• W4234309683 hasConceptScore W4234309683C2524010 @default.
• W4234309683 hasConceptScore W4234309683C33923547 @default.
• W4234309683 hasConceptScore W4234309683C86803240 @default.
• W4234309683 hasIssue "1" @default.
• W4234309683 hasLocation W42343096831 @default.
• W4234309683 hasOpenAccess W4234309683 @default.
• W4234309683 hasPrimaryLocation W42343096831 @default.
• W4234309683 hasRelatedWork W1641042124 @default.
• W4234309683 hasRelatedWork W1990804418 @default.
• W4234309683 hasRelatedWork W1993764875 @default.
• W4234309683 hasRelatedWork W2013243191 @default.
• W4234309683 hasRelatedWork W2082860237 @default.
• W4234309683 hasRelatedWork W2117258802 @default.
• W4234309683 hasRelatedWork W2130076355 @default.
• W4234309683 hasRelatedWork W2151865869 @default.
• W4234309683 hasRelatedWork W2748952813 @default.
• W4234309683 hasRelatedWork W2899084033 @default.
• W4234309683 hasVolume "36" @default.
• W4234309683 isParatext "false" @default.
• W4234309683 isRetracted "false" @default.
• W4234309683 workType "article" @default.