FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W4238261567> ?p ?o ?g. }

• W4238261567 endingPage "27020" @default.
• W4238261567 startingPage "27013" @default.
• W4238261567 abstract "ATF6 is a member of the basic-leucine zipper family of transcription factors. It contains a transmembrane domain and is located in membranes of the endoplasmic reticulum. ATF6 has been implicated in the endoplasmic reticulum (ER) stress response pathway since it can activate expression of GRP78 and other genes induced by the ER stress response. ER stress appears to activate ATF6 by cleavage from the ER membrane and translocation to the nucleus. However, direct DNA binding by ATF6 had not been demonstrated. In this report, we have identified a consensus DNA binding sequence for ATF6. This site is related to but distinct from ATF1/CREB binding sites. The site was placed in a reporter gene and was specifically activated by ATF6 overexpression and was strongly induced by the ER stress response. A dominant negative form of ATF6 blocked ER stress induction of both ATF6 site and GRP78 reporter genes. We further found that GAL4-ATF6 could be activated by ER stress. These results demonstrate that ATF6 is a direct target of the ER stress response. A proximal sensor of the ER stress response, human IRE1 (hIRE1), was sufficient to activate the ATF6 reporter gene, while a dominant negative form of hIRE1 blocked ER stress activation, suggesting that hIRE1 is upstream of ATF6 in the ER stress signaling pathway. ATF6 is a member of the basic-leucine zipper family of transcription factors. It contains a transmembrane domain and is located in membranes of the endoplasmic reticulum. ATF6 has been implicated in the endoplasmic reticulum (ER) stress response pathway since it can activate expression of GRP78 and other genes induced by the ER stress response. ER stress appears to activate ATF6 by cleavage from the ER membrane and translocation to the nucleus. However, direct DNA binding by ATF6 had not been demonstrated. In this report, we have identified a consensus DNA binding sequence for ATF6. This site is related to but distinct from ATF1/CREB binding sites. The site was placed in a reporter gene and was specifically activated by ATF6 overexpression and was strongly induced by the ER stress response. A dominant negative form of ATF6 blocked ER stress induction of both ATF6 site and GRP78 reporter genes. We further found that GAL4-ATF6 could be activated by ER stress. These results demonstrate that ATF6 is a direct target of the ER stress response. A proximal sensor of the ER stress response, human IRE1 (hIRE1), was sufficient to activate the ATF6 reporter gene, while a dominant negative form of hIRE1 blocked ER stress activation, suggesting that hIRE1 is upstream of ATF6 in the ER stress signaling pathway. endoplasmic reticulum ER stress response element basic-leucine zipper amino acids polymerase chain reaction cAMP-response element cAMP-response element-binding protein hemagglutinin human IRE1 murine IRE1β c-Jun N-terminal kinase presenilin-1 tunicamycin The endoplasmic reticulum (ER)1 stress response is a mechanism by which cells protect themselves from many noxious insults that cause protein unfolding in the ER (reviewed in Ref. 1Kaufman R.J. Genes Dev. 1999; 13: 1211-1233Crossref PubMed Scopus (1930) Google Scholar). Inducers of this response include inhibitors of glycosylation (tunicamycin), dithiothreitol, agents that affect calcium homeostasis such as calcium ionophores and thapsigargin (an inhibitor of an ER calcium-ATPase), and agents that perturb ER function and protein movement such as brefeldin A. The ER stress response (also known as the unfolded protein response) causes an increase in gene expression of a number of ER chaperones, such as GRP78/BiP and GRP94, and erp72, which is related to protein-disulfide isomerase (1Kaufman R.J. Genes Dev. 1999; 13: 1211-1233Crossref PubMed Scopus (1930) Google Scholar). These factors probably allow the cell to refold unfolded proteins in the ER. Analysis of the promoters of these genes has revealed a consensus sequence element, CCAATN9CCACG, that is required for ER stress induction of the promoters (2Yoshida H. Haze K. Yanagi H. Yura T. Mori K. J. Biol. Chem. 1998; 273: 33741-33749Abstract Full Text Full Text PDF PubMed Scopus (1014) Google Scholar, 3Roy B. Lee A.S. Nucleic Acids Res. 1999; 27: 1437-1443Crossref PubMed Scopus (216) Google Scholar). Mutation of this ER stress response element (ERSE) has shown that both the 5′ CCAAT and 3′ CCACG boxes are required. The variable central region was not sensitive to point mutations; however, some multiple base changes abolished activity (2Yoshida H. Haze K. Yanagi H. Yura T. Mori K. J. Biol. Chem. 1998; 273: 33741-33749Abstract Full Text Full Text PDF PubMed Scopus (1014) Google Scholar, 3Roy B. Lee A.S. Nucleic Acids Res. 1999; 27: 1437-1443Crossref PubMed Scopus (216) Google Scholar). Not surprisingly, NF-Y/CBP binds to the 5′ CCAAT box of the ERSE (4Roy B. Lee A.S. Mol. Cell. Biol. 1995; 15: 2263-2274Crossref PubMed Scopus (86) Google Scholar,5Roy B. Li W.W. Lee A.S. J. Biol. Chem. 1996; 271: 28995-29002Abstract Full Text Full Text PDF PubMed Scopus (58) Google Scholar); however, it has been less clear which factor(s) bind the element to mediate the ER stress response. In order to identify factors binding the ERSE, Yoshida et al. (2Yoshida H. Haze K. Yanagi H. Yura T. Mori K. J. Biol. Chem. 1998; 273: 33741-33749Abstract Full Text Full Text PDF PubMed Scopus (1014) Google Scholar) utilized a yeast one-hybrid approach and found ATF6. While they were not able to show that ATF6 bound the ERSE directly, overexpression of ATF6 activatedGRP78 reporter genes in mammalian cells in an ERSE site-dependent manner. They suggested that ATF6 can interact with the ERSE directly or indirectly in mammalian cells. ATF6 is a member of the ATF/CREB basic-leucine zipper (bZIP) DNA-binding protein family (6Hai T.W. Liu F. Coukos W.J. Green M.R. Genes Dev. 1989; 3: 2083-2090Crossref PubMed Scopus (755) Google Scholar). It is a 90-kDa protein with 670 amino acids (7Zhu C. Johansen F.E. Prywes R. Mol. Cell. Biol. 1997; 17: 4957-4966Crossref PubMed Scopus (139) Google Scholar). ATF6 contains a transmembrane domain at amino acids 378–398 with the N terminus facing the cytoplasm (8Haze K. Yoshida H. Yanagi H. Yura T. Mori K. Mol. Biol. Cell. 1999; 10: 3787-3799Crossref PubMed Scopus (1537) Google Scholar). By immunofluorescence and cell fractionation, Haze et al. (8Haze K. Yoshida H. Yanagi H. Yura T. Mori K. Mol. Biol. Cell. 1999; 10: 3787-3799Crossref PubMed Scopus (1537) Google Scholar) found that ATF6 resides in the ER. They were also able to identify an ER stress-induced 50-kDa cleavage product of ATF6, which is proposed to be an active form of the factor. Consistent with this model, the 50-kDa protein was found in nuclear fractions. In addition, expression of the cytoplasmic domain of ATF6 (aa 1–373) resulted in a protein that localized entirely in the nucleus and that activated expression of the GRP78 gene (8Haze K. Yoshida H. Yanagi H. Yura T. Mori K. Mol. Biol. Cell. 1999; 10: 3787-3799Crossref PubMed Scopus (1537) Google Scholar). We identified ATF6 in a yeast two hybrid-like screen interacting with the serum response factor, a transcription factor that controls growth factor induced expression of the c-fos gene (7Zhu C. Johansen F.E. Prywes R. Mol. Cell. Biol. 1997; 17: 4957-4966Crossref PubMed Scopus (139) Google Scholar). It is thus possible that ATF6 activation may affect other targets besides ERSE-containing genes. In order to characterize the function and mechanism of activation of ATF6, we describe here the identification of a consensus DNA binding site for ATF6. This site is activated by overexpression of ATF6 and by ER stress inducers. In addition, a GAL4-ATF6 fusion protein is regulated by ER stress, demonstrating that ATF6 can respond to this signal. Bacterial expression vector pET28bATF6bZIP was constructed by PCR amplification of the region of ATF6 encoding amino acids 287–432. This fragment was cloned into BamHI to XhoI sites of pET28b (Novagen) downstream of a polyhistidine tag. ATF6bZIP protein was expressed in Escherichia coli strain BLR (Novagen) from the pET28bATF6bzip vector and purified on Ni2+-agarose (Invitrogen) as described (9Wang B.Q. Kostrub C.F. Finkelstein A. Burton Z.F. Protein Expression Purif. 1993; 4: 207-214Crossref PubMed Scopus (44) Google Scholar). Selection of ATF6bZIP binding to random oligonucleotides was done by gel mobility shift assay essentially as described (10Mavrothalassitis G. Beal G. Papas T.S. DNA Cell Biol. 1990; 9: 783-788Crossref PubMed Scopus (36) Google Scholar). Briefly, the reaction conditions were 10 mm Tris-HCl, pH 7.5, 2 μg of herring sperm DNA, 1 mm DTT, and 20 ng of ATF6bZIP protein in 20 μl. This mixture was incubated with 1 ng of32P-labeled N15 probe for 1 h at room temperature and loaded on a 4% polyacrylamide gel in 0.25× TBE (25 mmTrizma base, 25 mm boric acid, 1 mm EDTA). The N15 probe was 5′-TACGGATCCCTACAGGTGCN15GCAATCCAGGAATTCGT-3′, where the central 15 nucleotides were random. It was annealed to PCR primer 2, 5′-ACGAATTCCTGGATTCG-3′, and extended with the Klenow fragment of E. coli DNA polymerase. The double-stranded oligonucleotide was then labeled with [γ-32P]ATP and T4 polynucleotide kinase. The position of the ATF6bZIP-DNA complex was estimated by comparison with the low affinity binding of the protein to a similarly labeled probe containing the c-fos AP1 site in the presence of 0.5 μg of herring sperm DNA. This position of the gel was excised from the gel, and the protein-bound DNA was soaked out of the gel slice in 10 mmTris-HCl, pH 8.0, 1 mm EDTA. The excised DNA was PCR-amplified using PCR primer 2 and PCR primer 1 (5′-TACGGATCCCTACAGGTGC-3′). The PCR product was32P-labeled and used for the next round of selection. This process was repeated for seven cycles. The PCR product from the sixth round of selection was subcloned into the BamHI andEcoRI sites of pBluescript II SK+ and sequenced. The following double-stranded oligonucleotides were synthesized for binding experiments with ATF6bZIP and ATF1.AFT6TCGAGACAGGTGCTGACGTGGCGATTCCAFT6mlTCGAGACAGGTGCTGACGTT¯GCGATTCCCRE(c­fos)GATCTTGAGCCCGTGACGTTTACACACTCASEQUENCES1–3The nucleotide mutated in ATF6m1 is underlined. Full-length ATF1 with a polyhistidine tag at the N terminus was cloned into pET28b at the NcoI and SalI sites. Histidine-tagged ATF1 was purified from E. coli on Ni2+-agarose as described (9Wang B.Q. Kostrub C.F. Finkelstein A. Burton Z.F. Protein Expression Purif. 1993; 4: 207-214Crossref PubMed Scopus (44) Google Scholar). Purified ATF6bZIP and ATF1 proteins were assayed for binding to the 32P-labeled oligonucleotides by gel mobility shift assay as described above. For competitions in Fig. 3 A, increasing amounts of the ATF6 oligonucleotide were added or, as a control, 100 ng of oligonucleotide RP4 (5′-TCGAGAAGCGCCCAGGCCCGCGCGCA-3′). Oligonucleotides ATF6 and ATF6m1 containing one of the selected ATF6 sites and a single base mutation (underlined) were used in reporter genes. Their sequences are as follows. ATF6CTCGAGACAGGTGCTGACGTGGCATTCATF6mlCTCGAGACAGGTGCTGACGTT¯GCGATTCSEQUENCES4AND5They were cloned into pOFluc-GL3 (11Clarke N. Arenzana N. Hai T. Minden A. Prywes R. Mol. Cell. Biol. 1998; 18: 1065-1073Crossref PubMed Scopus (95) Google Scholar) at an XhoI site 5′ to the c-fos minimal promoter (−53 to +45 of the human c-fos promoter) and the firefly luciferase gene. Plasmid p5×ATF6GL3 contains five repeats of the ATF6 oligonucleotide, while pATF6GL3 and pATF6m1GL3 contain one copy each of their respective sites. The p4×CRE-luciferase reporter was from Stratagene. The p5×GAL4-E1b-luc reporter contains five GAL4 sites upstream of the adenovirus E1b minimal promoter and the firefly luciferase gene. The rat GRP78-luciferase reporter gene with −304 to +7 of the rat GRP78 promoter was as described (2Yoshida H. Haze K. Yanagi H. Yura T. Mori K. J. Biol. Chem. 1998; 273: 33741-33749Abstract Full Text Full Text PDF PubMed Scopus (1014) Google Scholar). pCGNATF6 contains full-length ATF6 (aa 1–670) with an HA epitope tag at the N terminus as described (7Zhu C. Johansen F.E. Prywes R. Mol. Cell. Biol. 1997; 17: 4957-4966Crossref PubMed Scopus (139) Google Scholar). pCGNATF6-(1–373) contains amino acids 1–373 of ATF6 (generated by PCR amplification) in the XbaI–BamHI sites of pCGN (12Tanaka M. Herr W. Cell. 1990; 60: 375-386Abstract Full Text PDF PubMed Scopus (517) Google Scholar). pCGNATF6-(1–373)m1 was made from pCGNATF6-(1–373) with the QuikChange site-directed mutagenesis kit (Stratagene). Amino acids 315–317 were changed from KNR to TAA. pSV40Gal4ATF6 contains the SV40 early promoter driving expression of GAL4's DNA binding domain (aa 1–147) fused to full-length ATF6 (aa 1–670). The expression vector for hIRE1α, pED-hIRE1, was as described (13Tirasophon W. Welihinda A.A. Kaufman R.J. Genes Dev. 1998; 12: 1812-1824Crossref PubMed Scopus (741) Google Scholar). The dominant negative form of hIRE1α with the deletion of the C-terminal kinase and nuclease domains, pED-hIRE1ΔC, contains the coding region for amino acids 1–492 of hIRE1α. The cAMP-dependent protein kinase expression vector, pFC-PKA, was from Stratagene. HeLa cells were grown in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum. Cells were transfected by the calcium phosphate coprecipitation method (14Wang Y. Falasca M. Schlessinger J. Malstrom S. Tsichlis P. Settleman J. Hu W. Lim B. Prywes R. Cell Growth Differ. 1998; 9: 513-522PubMed Google Scholar). Each transfection mixture for a 60-mm diameter plate contained 0.5 μg of luciferase reporter gene, 0.1 μg of pRLSV40P as an internal control (15Chen X. Prywes R. Mol. Cell. Biol. 1999; 19: 4695-4702Crossref PubMed Scopus (68) Google Scholar), the indicated amounts of expression constructs, and herring sperm DNA to give a total of 10 μg of DNA. HeLa cells were transfected for 16–20 h and then induced with 2 μg/ml tunicamycin for 12 h. The transfected cells were lysed and assayed for firefly andRenilla luciferase activity using the dual luciferase kit (Promega). The results were normalized to the Renillaluciferase activity of the internal control. Each experiment was repeated four or more times. The average and the S.E. are shown. Cell lysates were prepared from transfected HeLa cells by resuspending the cells on the plate in 0.2 ml of 3× SDS sample buffer (6% SDS, 180 mm Tris-HCl (pH 6.8), 30% glycerol, 0.003% bromphenol blue, 1% β-mercaptoethanol) and boiled for 5 min. The lysates were analyzed by immunoblotting using a 1:1000 dilution of anti-HA monoclonal antibody (Babco). Horseradish peroxidase-conjugated goat anti-mouse IgG (Sigma) was used as a secondary antibody at a 1:4000 dilution, and the signal was visualized using the ECL chemiluminescence kit (Amersham Pharmacia Biotech). Since ATF6 is a bZIP protein of the ATF/CREB family, it was likely that it could bind directly to DNA. We expressed a fragment of ATF6 (aa 287–432) spanning the bZIP domain with a polyhistidine tag. We found that the purified protein was able to bind weakly to ATF-related sites such as the c-fos FAP1 site, which is immediately 3′ to the c-fos SRE (data not shown). Binding was readily apparent using 0.5 μg of herring sperm DNA as nonspecific competitor in the gel mobility shift assay but was not observed under more stringent conditions where we used 2 μg of herring sperm DNA. The binding was nearly undetectable under conditions where similar amounts of ATF1 bound a consensus ATF1/CREB site well (data not shown). We decided to look for higher affinity ATF6 DNA binding sites by selecting from a pool of random oligonucleotides by gel mobility shift assays (10Mavrothalassitis G. Beal G. Papas T.S. DNA Cell Biol. 1990; 9: 783-788Crossref PubMed Scopus (36) Google Scholar). We used a random oligonucleotide with 15 central random nucleotides and fixed ends allowing it to be amplified by PCR. We mixed the 32P-labeled random oligonucleotides with the purified ATF6bZIP protein in a gel mobility assay using the more stringent conditions of 2 μg of herring sperm DNA. The region of the gel where ATF6bZIP bound to the FAP1 site was excised, and the DNA was isolated and amplified by PCR. This amplified product was32P-labeled and used in another round of gel mobility shift assay selection. This process was repeated seven times. The results from cycles 2, 6, and 7 are shown in Fig.1. There was no clear band in cycles 1–4. A faint band was apparent at cycle 5. A strong band was observed at cycle 6 and was not further increased at cycle 7, suggesting that further rounds would not select for higher affinity sites (Fig. 1 and data not shown). We subcloned the PCR products from the sixth round of selection and sequenced 20 individual clones. These results are shown in Fig.2. Two sequences were found twice with all the others being unique. We tested all of the 20 products in a gel mobility shift assay for binding to ATF6bZIP protein and found they all bound similarly, although it was difficult to compare them quantitatively, since the amount of each product and the efficiency of32P labeling varied (data not shown). Notably, all the subclones contained the sequence TGACGT. The sequence TGACGT is also the core of ATF1/CREB sites (known as CREs), which have the consensus TGACGTCA (16Montminy M. Annu. Rev. Biochem. 1997; 66: 807-822Crossref PubMed Scopus (860) Google Scholar). We aligned the sequences according to the TGACGT core to determine a consensus binding site (Fig. 2). This suggests a consensus of (G)(G)TGACGTG(G/A), where the nucleotides in parentheses are less strongly maintained. We found that 18 of 20 had a G following the core sequence, suggesting that this nucleotide is particularly important. The flanking sequence that was fixed in the design of the random oligonucleotides may also contribute to binding by ATF6, since in 17 of 20 cases the core TGACGTG sequence was found juxtaposed to the 3′-flanking sequence. We have not included bases from the flanking sequence in the consensus; however, the final base of the consensus was G in two of four cases, and G is also the first base in the 3′-flanking sequence, suggesting a consensus of TGACGTGG. The only two sequences without GG at the end (sequence 2 in Fig. 2) seem to be exceptions to the rule and contain a perfect inverted repeat sequence TGACGTCA, which is identical to the ATF1/CREB consensus. To demonstrate that binding by ATF6 was specific, we synthesized a double-stranded oligonucleotide corresponding to sequence 1 in Fig. 2 and will refer to this as the ATF6 site. This oligonucleotide was 32P-labeled, and strong binding of ATF6 was observed in a gel mobility shift assay (Fig.3 A). This binding was competed away by excess unlabeled ATF6 site oligonucleotide but not by 100 ng of a nonspecific oligonucleotide (Fig. 3 A). Since the ATF6 consensus site is similar to CRE sites, we compared binding of ATF6 to these sites. We used a CRE oligonucleotide corresponding to the −60 CRE from the c-fos promoter, which contains the sequence TGACGTTT (17Fisch T.M. Prywes R. Roeder R.G. Mol. Cell. Biol. 1987; 7: 3490-3502Crossref PubMed Scopus (210) Google Scholar). ATF6 bound this site significantly more weakly than the ATF6 site (Fig. 3 B, lanes 1 and 3). We also mutated the ATF6 site from TGACGTGG to TGACGTTG (referred to as the ATF6m1 site). ATF6 bound the ATF6m1 site significantly more weakly than the ATF6 site (Fig. 3 B, lanes 1 and2), suggesting that the G flanking the TGACGT core is critical to ATF6-specific binding. In contrast, we found that purified ATF1 bound all three sites, with stronger binding to the CRE and ATF6m1 sites (Fig. 3 B, lanes 4–6). It is also apparent that ATF1 binding to the CRE site is similar to ATF6 binding to the ATF6 site (Fig. 3 B, comparelanes 6 and 1). Since high affinity binding of ATF1 to CRE sites is well characterized (16Montminy M. Annu. Rev. Biochem. 1997; 66: 807-822Crossref PubMed Scopus (860) Google Scholar), this suggests that ATF6 binds its site with high affinity. We next compared binding of ATF6 and ATF1 to the ATF6 site to further show that that ATF6 binds the site we have identified with high affinity compared with ATF1. A titration of similar amounts of these factors showed that ATF6 binds its site significantly better than ATF1 (Fig. 3 C). To check whether the ATF6 consensus DNA binding site can function in vivo, we constructed a luciferase reporter gene with five ATF6 sites in front of the c-fos minimal promoter. This reporter was transfected into HeLa cells along with a full-length (aa 1–670) ATF6 expression vector. ATF6 strongly activated the 5× ATF6 site reporter (Fig. 4 A). There was no effect of ATF6 on the internal control of the SV40 promoter driving a Renilla luciferase gene (data not shown). In order to determine whether the ATF6 sites were targets for the ER stress response, we treated the transfected cells with or without tunicamycin. Tunicamycin strongly activated the 5× ATF6-luciferase gene 30-fold (Fig. 4 A). Tunicamycin also further increased ATF6 activation of the reporter, but only by about 2-fold. A reporter gene lacking the ATF6 sites was not induced by tunicamycin (data not shown). The internal control of SV40-Renilla luciferase was consistently reduced by tunicamycin treatment by about 50%, perhaps due to toxicity, and we have normalized the results to theRenilla luciferase activity to account for possible cell loss and variations in transfection efficiencies. We also found that other ER stress inducers, including thapsigargin and brefeldin A, induced expression of the 5× ATF6 reporter gene (data not shown). These results suggest that ATF6 is a general target of agents that induce the ER stress response and that the ATF6 site is a direct target of ATF6 in cells. Haze et al. (8Haze K. Yoshida H. Yanagi H. Yura T. Mori K. Mol. Biol. Cell. 1999; 10: 3787-3799Crossref PubMed Scopus (1537) Google Scholar) found that the cytoplasmic domain of ATF6 localized to the nucleus and activated GRP78 gene expression. We tested whether a similar ATF6 construct (aa 1–373) lacking the transmembrane and ER luminal domains could activate the 5× ATF6 site reporter. We used increasing amounts of ATF6-(1–373) and full-length ATF6 to compare their ability to activate the reporter. ATF6-(1–373) strongly activated the 5× ATF6 site reporter with as little as 10 ng of plasmid, activating as strongly as 3 μg of full-length ATF6 (Fig. 4 B). To correlate this with ATF6 protein expression, we assayed transfected cell lysates by immunoblotting with antisera to the HA epitope tag at the N terminus of the ATF6 constructs. We found that transfection of 30 ng of ATF6-(1–373) gave a similar level of protein expression as 1 μg of full-length ATF6 (Fig. 4 C). However, 30 ng of ATF6-(1–373) strongly activated reporter gene expression, while 1 μg of full-length ATF6 had little effect (Fig. 4 B). This demonstrates that ATF6-(1–373) is an activated form of ATF6. We also tested by immunofluorescence whether the ATF6 constructs localized to the ER or the nucleus. Similar to the results of Hazeet al. (8Haze K. Yoshida H. Yanagi H. Yura T. Mori K. Mol. Biol. Cell. 1999; 10: 3787-3799Crossref PubMed Scopus (1537) Google Scholar), full-length ATF6 was localized outside the nucleus, consistent with ER localization, while ATF6-(1–373) was entirely localized to the nucleus (data not shown). Haze et al. (8Haze K. Yoshida H. Yanagi H. Yura T. Mori K. Mol. Biol. Cell. 1999; 10: 3787-3799Crossref PubMed Scopus (1537) Google Scholar) detected a 50-kDa cleavage product of ATF6 that was induced by tunicamycin treatment. This was observed using antisera to endogenous ATF6. We have not been able to detect this 50-kDa fragment using our anti-ATF6 serum (7Zhu C. Johansen F.E. Prywes R. Mol. Cell. Biol. 1997; 17: 4957-4966Crossref PubMed Scopus (139) Google Scholar), at least partially due to the high background observed with this serum (data not shown). Upon overexpression of ATF6, Haze et al. (8Haze K. Yoshida H. Yanagi H. Yura T. Mori K. Mol. Biol. Cell. 1999; 10: 3787-3799Crossref PubMed Scopus (1537) Google Scholar) did not observe tunicamycin-induced ATF6 cleavage but did detect the constitutive presence of the 50-kDa cleavage product using anti-HA epitope sera and the same ATF6 construct as we have used. We have not clearly detected the 50-kDa form of ATF6 using the anti-HA sera (Fig. 4 C, lanes 9 and 10). Using 3 μg of ATF6 plasmid, which is the amount that activates reporter gene expression, we do detect a generally higher background (Fig. 4 C, lane 10) such that there may be basal cleavage at multiple sites leading to translocation of the ATF6 cytoplasmic domain to the nucleus. While a band is seen near the 50-kDa marker in lane 10, upon longer exposure this band is also present in all of the other lanes. It is possible that a fragment of ATF6 comigrates with the background band at about 55 kDa or that it is simply below the limits of our detection. This is possible, since low levels (3 ng) of ATF6-(1–373) partially activated the reporter gene (Fig. 4 B) but were nearly undetectable in the immunoblot (Fig. 4 C, lane 3). Further work will be required to resolve this issue (see “Discussion”). Since the ATF6 site we have identified is similar to the consensus CRE site, we compared the ability of a 4× CRE luciferase reporter gene (with the multimerized sequence TGACGTCA) to be induced by tunicamycin and activated by ATF6. In contrast to the 5× ATF6 reporter, the CRE reporter was not induced by tunicamycin or by overexpression of ATF6-(1–373) (Fig. 5 A). As a control, the 4× CRE reporter was strongly activated by the catalytic subunit of cAMP-dependent protein kinase. The consensus ATF6 site contrasts with CRE sites in that it contains a G 3′ to the TGACGT core CRE sequence. We therefore tested the importance of this nucleotide by comparing reporter genes with one copy of the ATF6 site (TGACGTG) or the ATF6m1 mutant site (TGACGTT). In vitro ATF6 bound the ATF6m1 site significantly more weakly than the ATF6 site, while ATF1 bound the ATF6m1 site somewhat better (Fig. 3 B). The 1× ATF6 site reporter gene was induced by tunicamycin and ATF6-(1–373), although the activation was weaker than the 5× ATF6 reporter (Fig.5 B). In contrast, the ATF6m1 reporter was neither induced by tunicamycin nor activated by ATF6-(1–373). These results indicate that the activation of the ATF6 consensus site by tunicamycin and ATF6 is specific to the ATF6 consensus site and correlates with binding of ATF6 to the sites in vitro. Since the ATF6 site reporter genes were activated by ER stress inducers, we sought to test whether endogenous ATF6 is required for this activation using a potentially dominant negative form of ATF6. We made point mutations in the basic region of ATF6 in the context of ATF6-(1–373). These mutations (KNR to TAA at aa 315–317) would be predicted to disrupt DNA binding activity of the cytoplasmic domain. It would act as a dominant negative if it dimerized with endogenous ATF6 and prevented its binding to ATF6 DNA binding sites. This construct, ATF6-(1–373)m1, did not activate the 5× ATF6 site reporter, as expected, and completely inhibited tunicamycin induction of the reporter (Fig. 6 A). There was no effect of ATF6-(1–373)m1 on the SV40 promoter-Renillaluciferase internal control. The inhibition of tunicamycin induction of the ATF6 site by the ATF6 dominant negative mutants strongly suggests that endogenous ATF6 is mediating tunicamycin induction through this site. To test whether ATF6 is required for ER stress induction of theGRP78 gene, which contains three ERSE elements, we transfected ATF6-(1–373)m1 with a rat GRP78 promoter reporter gene. This reporter was induced 3.5-fold by tunicamycin, and this induction was reduced to 1.6-fold by ATF6-(1–373)m1 (Fig.6 B). Since levels of endogenous ATF6 appear to be sufficient to mediate tunicamycin induction of the ATF6 site, we were not able to show directly by transfection of ATF6 that it is required for induction of the site. In order to confirm that ATF6 can be activated by the ER stress response, we fused it to the GAL4 DNA binding domain and tested whether a 5× GAL4 site-luciferase reporter gene could then be induced by tunicamycin. While the GAL4 reporter was not induced by tunicamycin, cotransfection of increasing amounts of GAL4-ATF6 resulted in tunicamycin induction of the reporter (Fig.7). Only the highest amounts of GAL4-ATF6 activated the reporter without tunicamycin induction. This is similar to the activation we see with full-length ATF6 (Fig. 4 B) and may represent basal cleavage of the protein, releasing the cytoplasmic domain from the membrane. The tunicamycin induction of GAL4-ATF6 clearly shows that ATF6 is a target of the ER stress response. Ire1p is an ER transmembrane protein that is required for the ER stress response in the budding yeast, Saccharomyces cerevisiae (18Cox J.S. Shamu C.E. Walter P. Cell. 1993; 73: 1197-1206Abstract Full Text PDF PubMed Scopus (935) Google Scholar, 19Mori K. Ma W. Gething M.J. Sambrook J. Cell. 1993; 74: 743-756Abstract Full Text PDF PubMed Scopus (651) Google Scholar). Ire1p contains a cytoplasmic protein kinase domain along with a domain similar to endoribonuclease RNase L (20Sidrauski C. Walter P. Cell. 1997; 90: 1031-1039Abstract Full Text Full Text PDF PubMed Scopus (667) Google Scholar). Yeast Ire1p can be activated by ER stress signals, which leads to activation of its ribonuclease activity. This activity causes the cleavage of an mRNA for the transcription factor Hac1p at two sites removing an intron. The cleaved mRNA is subsequently religated by a tRNA ligase. This results in enhanced translation of Hac1p, which activates ER stress-responsive genes in yeast (20Sidrauski C. Walter P. Cell. 1997; 90: 1031-1039Abstract Full Text Full Text PDF PubMed Scopus (667) Google Scholar, 21Kawahara T. Yanagi H. Yura T. Mori K. Mol. Biol. Cell. 1997; 8: 1845-1862Crossref PubMed Scopus (23" @default.
• W4238261567 created "2022-05-12" @default.
• W4238261567 creator A5003642180 @default.
• W4238261567 creator A5015378855 @default.
• W4238261567 creator A5020566486 @default.
• W4238261567 creator A5025103079 @default.
• W4238261567 creator A5061532825 @default.
• W4238261567 creator A5087366990 @default.
• W4238261567 date "2000-09-01" @default.
• W4238261567 modified "2023-10-17" @default.
• W4238261567 title "Activation of ATF6 and an ATF6 DNA Binding Site by the Endoplasmic Reticulum Stress Response" @default.
• W4238261567 cites W1595935608 @default.
• W4238261567 cites W1655397332 @default.
• W4238261567 cites W1660631781 @default.
• W4238261567 cites W1675105744 @default.
• W4238261567 cites W1967883750 @default.
• W4238261567 cites W1970761589 @default.
• W4238261567 cites W1973130935 @default.
• W4238261567 cites W1984751884 @default.
• W4238261567 cites W1987109846 @default.
• W4238261567 cites W1990400035 @default.
• W4238261567 cites W1995231578 @default.
• W4238261567 cites W1996068610 @default.
• W4238261567 cites W2000550532 @default.
• W4238261567 cites W2001664444 @default.
• W4238261567 cites W2005681172 @default.
• W4238261567 cites W2007334178 @default.
• W4238261567 cites W2021028081 @default.
• W4238261567 cites W2022713347 @default.
• W4238261567 cites W2030111014 @default.
• W4238261567 cites W2034213169 @default.
• W4238261567 cites W2036677133 @default.
• W4238261567 cites W2045153164 @default.
• W4238261567 cites W2046209489 @default.
• W4238261567 cites W2046640957 @default.
• W4238261567 cites W2050030183 @default.
• W4238261567 cites W2055836716 @default.
• W4238261567 cites W2066877759 @default.
• W4238261567 cites W2080901528 @default.
• W4238261567 cites W2081294646 @default.
• W4238261567 cites W2095745901 @default.
• W4238261567 cites W2106983618 @default.
• W4238261567 cites W2107601804 @default.
• W4238261567 cites W2109399660 @default.
• W4238261567 cites W2124220437 @default.
• W4238261567 cites W2130764195 @default.
• W4238261567 cites W2131954729 @default.
• W4238261567 cites W2144065739 @default.
• W4238261567 cites W2154901227 @default.
• W4238261567 cites W2155884826 @default.
• W4238261567 cites W2163910466 @default.
• W4238261567 cites W2169488737 @default.
• W4238261567 cites W2170673015 @default.
• W4238261567 cites W2171882089 @default.
• W4238261567 doi "https://doi.org/10.1016/s0021-9258(19)61473-0" @default.
• W4238261567 hasPublicationYear "2000" @default.
• W4238261567 type Work @default.
• W4238261567 citedByCount "423" @default.
• W4238261567 countsByYear W42382615672012 @default.
• W4238261567 countsByYear W42382615672013 @default.
• W4238261567 countsByYear W42382615672014 @default.
• W4238261567 countsByYear W42382615672015 @default.
• W4238261567 countsByYear W42382615672016 @default.
• W4238261567 countsByYear W42382615672017 @default.
• W4238261567 countsByYear W42382615672018 @default.
• W4238261567 countsByYear W42382615672019 @default.
• W4238261567 countsByYear W42382615672020 @default.
• W4238261567 countsByYear W42382615672021 @default.
• W4238261567 countsByYear W42382615672022 @default.
• W4238261567 countsByYear W42382615672023 @default.
• W4238261567 crossrefType "journal-article" @default.
• W4238261567 hasAuthorship W4238261567A5003642180 @default.
• W4238261567 hasAuthorship W4238261567A5015378855 @default.
• W4238261567 hasAuthorship W4238261567A5020566486 @default.
• W4238261567 hasAuthorship W4238261567A5025103079 @default.
• W4238261567 hasAuthorship W4238261567A5061532825 @default.
• W4238261567 hasAuthorship W4238261567A5087366990 @default.
• W4238261567 hasBestOaLocation W42382615671 @default.
• W4238261567 hasConcept C12554922 @default.
• W4238261567 hasConcept C139447449 @default.
• W4238261567 hasConcept C158617107 @default.
• W4238261567 hasConcept C185592680 @default.
• W4238261567 hasConcept C2778997996 @default.
• W4238261567 hasConcept C552990157 @default.
• W4238261567 hasConcept C55493867 @default.
• W4238261567 hasConcept C86803240 @default.
• W4238261567 hasConcept C95444343 @default.
• W4238261567 hasConceptScore W4238261567C12554922 @default.
• W4238261567 hasConceptScore W4238261567C139447449 @default.
• W4238261567 hasConceptScore W4238261567C158617107 @default.
• W4238261567 hasConceptScore W4238261567C185592680 @default.
• W4238261567 hasConceptScore W4238261567C2778997996 @default.
• W4238261567 hasConceptScore W4238261567C552990157 @default.
• W4238261567 hasConceptScore W4238261567C55493867 @default.
• W4238261567 hasConceptScore W4238261567C86803240 @default.
• W4238261567 hasConceptScore W4238261567C95444343 @default.
• W4238261567 hasIssue "35" @default.
• W4238261567 hasLocation W42382615671 @default.

• next