FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W4249702968> ?p ?o ?g. }

• W4249702968 endingPage "2481" @default.
• W4249702968 startingPage "2481" @default.
• W4249702968 abstract "HomePlant DiseaseVol. 103, No. 9First Report of the Root-Knot Nematode Meloidogyne enterolobii Infecting Mulberry in China PreviousNext DISEASE NOTES OPENOpen Access licenseFirst Report of the Root-Knot Nematode Meloidogyne enterolobii Infecting Mulberry in ChinaY. F. Sun, H. B. Long, and F. P. LuY. F. SunEnvironment and Plant Protection Institute, Chinese Academy of Tropical Agricultural Sciences, Haikou, Hainan 571101, ChinaSearch for more papers by this author, H. B. Long†Corresponding author: H. B. Long; E-mail Address: [email protected]http://orcid.org/0000-0002-7648-6567Environment and Plant Protection Institute, Chinese Academy of Tropical Agricultural Sciences, Haikou, Hainan 571101, ChinaSearch for more papers by this author, and F. P. LuEnvironment and Plant Protection Institute, Chinese Academy of Tropical Agricultural Sciences, Haikou, Hainan 571101, ChinaSearch for more papers by this authorAffiliationsAuthors and Affiliations Y. F. Sun H. B. Long † F. P. Lu Environment and Plant Protection Institute, Chinese Academy of Tropical Agricultural Sciences, Haikou, Hainan 571101, China Published Online:22 Jul 2019https://doi.org/10.1094/PDIS-03-19-0648-PDNAboutSections ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat Mulberry (Morus spp.) is an economically important perennial tree that has traditionally been used for feeding the silkworm. Its habitat ranges widely from cold to tropical regions. In September 2018, several mulberry (M. alba) trees in an orchard in Haikou City (N 19°19′18.48″, E 108°54′39.20″), Hainan Province, China, were observed with symptoms of decline, including stunting, wilting, and yellowing of the leaves. Root systems of sick plants (n = 10) had many galls, the typical symptoms of root-knot nematode infection, and the incidence of infection was 100%. Meloidogyne spp. females and egg masses were dissected from the roots of the affected trees. Each root contained about 83 females on average (n = 10). The perineal patterns of females (n = 10) were round to oval shaped with moderate to high dorsal arches. Second-stage juveniles (J2) had large and triangular lateral lips and broad, bluntly rounded tail tips. The J2 body length (n = 10) averaged 460.3 ± 22.9 μm (429.8 to 490.1 μm) with a mean width of 19.9 ± 1.2 μm (18.3 to 21.7 μm); stylet lengths were 16.1 ± 0.4 μm (15.3 to 16.7 μm); tail was narrow and length averaged 55.6 ± 2.2 μm (52.7 to 59.2 μm). These morphological characteristics fit those of the original description for Meloidogyne enterolobii (Yang and Eisenback 1983). Identification was further confirmed after DNA extraction from 14 single mature females, and the mitochondrial (mtDNA) region between COII and the 16S gene was amplified with primers C2F3/1108 (GGTCAATGTTCAGAAATTTGTGG/TACCTTTGACCAATCACGCT) (Powers and Harris 1993). A 705-bp DNA fragment was obtained, and the sequence (GenBank accession no. MK455870) was 100% identical to the sequences of M. enterolobii isolates from Mexico (KF360358), China (KR064786), and America (AY446969). Furthermore, species identification was also confirmed using PCR to amplify rDNA-IGS2 with M. enterolobii-specific primers Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC) (Long et al. 2006). An expected PCR fragment of approximately 200 bp was obtained, which was consistent with those previously reported for M. enterolobii. No amplification products were observed in either negative (M. incognita and M. javanica DNA) or blank (no DNA) controls. Therefore, this population of Meloidogyne sp. isolated from mulberry trees was identified to be M. enterolobii based upon morphological and molecular characteristics. For the pathogenicity test in the greenhouse, mulberry plants of cultivar Kangqing 283 maintained in pots were inoculated with 3,000 J2 and eggs of the original population of M. enterolobii using five replicates; noninoculated plants were used as a control. After 60 days, all inoculated plants had galled roots similar to those observed in the field. Reproduction factor (RF = final population/initial population) of 16.2 was obtained. The noninoculated plants did not present galls in the roots. These results confirmed the nematode’s pathogenicity on mulberry. M. enterolobii represents a significant threat to mulberry production because it is considered the most aggressive root-knot nematode in tropical regions (Castagnone-Sereno 2012). Further research is needed to assess yield losses in mulberry owing to M. enterolobii. To our knowledge, this is the first report of mulberry as a host of M. enterolobii in China.The author(s) declare no conflict of interest.References:Castagnone-Sereno, P. 2012. Nematology 14:133. https://doi.org/10.1163/156854111X601650 Crossref, ISI, Google ScholarLong, H., et al. 2006. Acta Phytopathol. Sin. 36:109. Google ScholarPowers, T. O., and Harris, T. S. 1993. J. Nematol. 25:1. ISI, Google ScholarYang, B., and Eisenback, J. D. 1983. J. Nematol. 15:381. ISI, Google ScholarThe author(s) declare no conflict of interest.Funding: This research was funded by the Hainan Nature Sciences Foundation (318MS104) and the Central Public-Interest Scientific Institution Basal Research Fund for Chinese Academy of Tropical Agricultural Sciences (1630042017024).DetailsFiguresLiterature CitedRelated Vol. 103, No. 9 September 2019SubscribeISSN:0191-2917e-ISSN:1943-7692 DownloadCaptionLeaf spot caused by Allophoma tropica on lettuce (Gullino et al.). Photo credit: M. L. Gullino. Red grapevine leaves showing symptoms of ‘Candidatus Phytoplasma solani’ (Jamshidi et al.). Photo credit: G. Romanazzi. Metrics Article History Issue Date: 30 Aug 2019Published: 22 Jul 2019First Look: 22 May 2019Accepted: 17 May 2019 Pages: 2481-2481 Information© 2019 The American Phytopathological SocietyFundingHainan Nature Sciences FoundationGrant/Award Number: 318MS104Central Public-Interest Scientific Institution Basal Research Fund for Chinese Academy of Tropical Agricultural SciencesGrant/Award Number: 1630042017024Keywordsnematodestree fruitspathogen detectionThe author(s) declare no conflict of interest.Cited byMeloidogyne enterolobii risk to agriculture, its present status and future prospective for management24 January 2023 | Frontiers in Plant Science, Vol. 13Occurrence and Identification of Root-Knot Nematodes on Red Dragon Fruit (Hylocereus polyrhizus) in Hainan, China28 April 2022 | Agronomy, Vol. 12, No. 5Genomic Designing for Biotic Stress Resistance in Mulberry19 October 2022" @default.
• W4249702968 created "2022-05-12" @default.
• W4249702968 creator A5071592275 @default.
• W4249702968 creator A5072959298 @default.
• W4249702968 creator A5077512869 @default.
• W4249702968 date "2019-09-01" @default.
• W4249702968 modified "2023-10-16" @default.
• W4249702968 title "First Report of the Root-Knot Nematode <i>Meloidogyne enterolobii</i> Infecting Mulberry in China" @default.
• W4249702968 cites W2043886826 @default.
• W4249702968 doi "https://doi.org/10.1094/pdis-03-19-0648-pdn" @default.
• W4249702968 hasPublicationYear "2019" @default.
• W4249702968 type Work @default.
• W4249702968 citedByCount "4" @default.
• W4249702968 countsByYear W42497029682022 @default.
• W4249702968 countsByYear W42497029682023 @default.
• W4249702968 crossrefType "journal-article" @default.
• W4249702968 hasAuthorship W4249702968A5071592275 @default.
• W4249702968 hasAuthorship W4249702968A5072959298 @default.
• W4249702968 hasAuthorship W4249702968A5077512869 @default.
• W4249702968 hasBestOaLocation W42497029681 @default.
• W4249702968 hasConcept C144027150 @default.
• W4249702968 hasConcept C166957645 @default.
• W4249702968 hasConcept C18903297 @default.
• W4249702968 hasConcept C191935318 @default.
• W4249702968 hasConcept C205649164 @default.
• W4249702968 hasConcept C2776207046 @default.
• W4249702968 hasConcept C2778830712 @default.
• W4249702968 hasConcept C59822182 @default.
• W4249702968 hasConcept C86803240 @default.
• W4249702968 hasConcept C90355303 @default.
• W4249702968 hasConceptScore W4249702968C144027150 @default.
• W4249702968 hasConceptScore W4249702968C166957645 @default.
• W4249702968 hasConceptScore W4249702968C18903297 @default.
• W4249702968 hasConceptScore W4249702968C191935318 @default.
• W4249702968 hasConceptScore W4249702968C205649164 @default.
• W4249702968 hasConceptScore W4249702968C2776207046 @default.
• W4249702968 hasConceptScore W4249702968C2778830712 @default.
• W4249702968 hasConceptScore W4249702968C59822182 @default.
• W4249702968 hasConceptScore W4249702968C86803240 @default.
• W4249702968 hasConceptScore W4249702968C90355303 @default.
• W4249702968 hasFunder F4320327861 @default.
• W4249702968 hasIssue "9" @default.
• W4249702968 hasLocation W42497029681 @default.
• W4249702968 hasOpenAccess W4249702968 @default.
• W4249702968 hasPrimaryLocation W42497029681 @default.
• W4249702968 hasRelatedWork W1988236371 @default.
• W4249702968 hasRelatedWork W2029154799 @default.
• W4249702968 hasRelatedWork W2045715590 @default.
• W4249702968 hasRelatedWork W2051445368 @default.
• W4249702968 hasRelatedWork W2073607434 @default.
• W4249702968 hasRelatedWork W2790478742 @default.
• W4249702968 hasRelatedWork W2901990429 @default.
• W4249702968 hasRelatedWork W2966467550 @default.
• W4249702968 hasRelatedWork W4248365408 @default.
• W4249702968 hasRelatedWork W3095276165 @default.
• W4249702968 hasVolume "103" @default.
• W4249702968 isParatext "false" @default.
• W4249702968 isRetracted "false" @default.
• W4249702968 workType "article" @default.