FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W4253573190> ?p ?o ?g. }

• W4253573190 endingPage "284" @default.
• W4253573190 startingPage "272" @default.
• W4253573190 abstract "Введение. В 2016 году в ауле Баганалы Аулиекольского района Костанайской области Казахстана очевидец якобы обнаружил в куче угля некий «кокон», из которого выбрался странный белый «червь» около 20 см в длину. При первичном морфологическом и гистологическом анализе не удалось достоверно установить его видовую принадлежность. Некоторыми СМИ была озвучена версия, что это может быть мифическое существо – олгой-хорхой, легенды о котором распространены по всей Центральной Азии. Авторам были переданы образцы «баганалинского червя» для их более детального молекулярно-генетического анализа.Цель. Установить таксономическую принадлежность находки из Костанайского района Казахстана методом ПЦР-анализа.Материалы и методы. Выделение ДНК из образца проводили методом экстракции смесью фенола и хлороформа. Участок гена цитохрома b (более 400 п.н.) амплифицировали с использованием универсальных праймеров mcb398 (TACCATGAGGACAAATATCATTCTG) и mcb869 (CCTCCTAGTTTGTTAGGGATTGATCG). Полимеразную цепную реакцию (ПЦР) осуществляли в объеме 15 мкл. ПЦР-продукты очищали с помощью набора NucleoSpin Gel and PCR Clean-up (Macherey-Nagel, Германия) и секвенировали в двух повторностях с использованием BrilliantDye™ Terminator Cycle Sequencing Kit v3.1 (Nimagen) и генетического анализатора ABI Prism 3500 Genetic Analyzer (Thermo, США).Результаты и обсуждение. Анализ с помощью онлайн-ресурса Nucleotide BLAST показал гомологию с последовательностями Bos taurus (без уточнения подвида). Таким образом, образцы, представленные на анализ, могут быть идентифицированы как принадлежащие крупнорогатому скоту. По совокупности молекулярно-генетических и гистологических данных можно заключить, что образец «баганалинского червя» – это фрагмент трубчатых органов Bos Taurus taurus.Заключение. Образцы, представленные на анализ, могут быть идентифицированы как фрагмент трубчатых органов коровы (Bos Taurus taurus), с высокой долей вероятности – рога матки или фрагмента пищевода. Наглядно показано, как рождаются современные слухи об олгой-хорхое и как им может противостоять современная наука. Олгой-хорхой и сходные с ним представители мифологических пресмыкающихся – не некое известное или даже неизвестное существо, а лишь собирательный образ, за которым кроются для каждой конкретной местности различные виды животных, чаще всего неядовитые. Introduction. In 2016, in the aul Baganaly of the Auliekol district of the Kostanay region of Kazakhstan, an eyewitness allegedly found a cocoon in a pile of coal, from which a strange white worm about 20 cm in length got out. Primary morphological and histological analysis failed to reliably reveal its species. Some media announced a version that it may be a mythical creature – olhgoi-horkhoi, the legends of which are spread throughout Central Asia. The authors were given samples of baganalin worm for more detailed molecular genetic analysis.Purpose. To reveal the taxonomic affiliation of the find from Kostanay region of Kazakhstan with the help of PCR analysis.Materials and methods. DNA isolation from the sample was performed by extraction with a mixture of phenol and chloroform. The cytochrome b gene fragment (over 400 BP) was amplified using the universal primers mcb398 (TACCATGAGGACAAATATCATTCTG) and mcb869 (CCTCCTAGTTTGTTAGGGATTGATCG). Polymerase chain reaction (PCR) was carried out in the volume of 15 microliters. The PCR products were purified using NucleoSpin Gel and PCR Clean-up kit (Macherey-Nagel, Germany) and sequenced in two repeats using BrilliantDye™ Terminator Cycle Sequencing Kit v3.1 (Nimagen) and ABI Prism 3500 Genetic Analyzer (Thermo, USA).Results and discussion. The analysis using the online resource Nucleotide BLAST showed the homology with Bos taurus sequences (without specifying the subspecies). Thus, the samples submitted for analysis can be identified as belonging to cattle, most likely a cow (Bos Taurus taurus). From the totality of molecular genetic and histological data, we can conclude that the sample of the baganalin worm is a fragment of the tubular organs of Bos Taurus taurus, with a high probability, the horns of the uterus.Conclusion. The samples submitted for analysis can be identified as a fragment of the tubular organs of a cow (Bos Taurus taurus), with a high probability, the horns of the uterus or esophagus. It shows how modern rumors about olhgoi-horkhoi are born and how modern science can resist them. Olgoi-horchoi and similar mythological reptiles are not some known or even unknown creature, but only a collective image, behind which various types of animals, most often non-poisonous, are hidden in each specific area." @default.
• W4253573190 created "2022-05-12" @default.
• W4253573190 creator A5008573147 @default.
• W4253573190 creator A5080176119 @default.
• W4253573190 creator A5087282394 @default.
• W4253573190 date "2020-10-20" @default.
• W4253573190 modified "2023-10-14" @default.
• W4253573190 title "Molecular-Genetic Analysis of the Tissue Sample of Baganalinsky Worm" @default.
• W4253573190 cites W1538817837 @default.
• W4253573190 cites W2113153297 @default.
• W4253573190 cites W2971066230 @default.
• W4253573190 cites W29731457 @default.
• W4253573190 doi "https://doi.org/10.34883/pi.2020.9.3.008" @default.
• W4253573190 hasPublicationYear "2020" @default.
• W4253573190 type Work @default.
• W4253573190 citedByCount "0" @default.
• W4253573190 crossrefType "journal-article" @default.
• W4253573190 hasAuthorship W4253573190A5008573147 @default.
• W4253573190 hasAuthorship W4253573190A5080176119 @default.
• W4253573190 hasAuthorship W4253573190A5087282394 @default.
• W4253573190 hasConcept C104317684 @default.
• W4253573190 hasConcept C116403925 @default.
• W4253573190 hasConcept C121332964 @default.
• W4253573190 hasConcept C1276947 @default.
• W4253573190 hasConcept C153911025 @default.
• W4253573190 hasConcept C178046730 @default.
• W4253573190 hasConcept C49105822 @default.
• W4253573190 hasConcept C54355233 @default.
• W4253573190 hasConcept C78063203 @default.
• W4253573190 hasConcept C86803240 @default.
• W4253573190 hasConceptScore W4253573190C104317684 @default.
• W4253573190 hasConceptScore W4253573190C116403925 @default.
• W4253573190 hasConceptScore W4253573190C121332964 @default.
• W4253573190 hasConceptScore W4253573190C1276947 @default.
• W4253573190 hasConceptScore W4253573190C153911025 @default.
• W4253573190 hasConceptScore W4253573190C178046730 @default.
• W4253573190 hasConceptScore W4253573190C49105822 @default.
• W4253573190 hasConceptScore W4253573190C54355233 @default.
• W4253573190 hasConceptScore W4253573190C78063203 @default.
• W4253573190 hasConceptScore W4253573190C86803240 @default.
• W4253573190 hasIssue "3" @default.
• W4253573190 hasLocation W42535731901 @default.
• W4253573190 hasOpenAccess W4253573190 @default.
• W4253573190 hasPrimaryLocation W42535731901 @default.
• W4253573190 hasRelatedWork W1004483767 @default.
• W4253573190 hasRelatedWork W1988958686 @default.
• W4253573190 hasRelatedWork W1991107912 @default.
• W4253573190 hasRelatedWork W2069771231 @default.
• W4253573190 hasRelatedWork W2071122502 @default.
• W4253573190 hasRelatedWork W2080534576 @default.
• W4253573190 hasRelatedWork W2276709808 @default.
• W4253573190 hasRelatedWork W2323003408 @default.
• W4253573190 hasRelatedWork W2324246793 @default.
• W4253573190 hasRelatedWork W2741610602 @default.
• W4253573190 isParatext "false" @default.
• W4253573190 isRetracted "false" @default.
• W4253573190 workType "article" @default.