FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W4280498976> ?p ?o ?g. }

• W4280498976 endingPage "971" @default.
• W4280498976 startingPage "971" @default.
• W4280498976 abstract "Pepino mosaic virus (PepMV), a member of the genus Potexvirus in the family Alphaflexiviridae, has been responsible for economic losses in tomato across Africa, Asia, Europe, and the Americas over the last two decades, but has not previously been reported in South Korea. In December 2020, virus-like symptoms (foliar interveinal chlorosis and unevenly discolored fruits) were observed on ~5% of tomato (Solanum lycopersicum) plants growing in a greenhouse in Jeolla province, South Korea. To identify the causal virus, total RNA from a leaf sample of the symptomatic tomato was extracted using an RNeasy Plant Mini Kit (Qiagen, Germany) and analyzed by high-throughput sequencing. Ribosomal RNA was removed and a cDNA library was prepared using an Illumina TruSeq Stranded Total RNA LT Sample Prep Kit (Plants) and sequenced on an Illumina NovaSeq 6000 system (Macrogen, Korea), yielding 151 nt paired end reads. De novo assembly of the 74,417,192 reads was performed using Trinity software (r20140717) while the 308,940 initially assembled contigs were screened against the NCBI viral genome database using BLASTN. Two contigs of 6,419 and 6,391 bp (GenBank LC656469, JKT1; and LC656470, JKT2) shared 94.81% and 98.34% nucleotide (nt) identities with isolates of the CH2 group (MK133092 and MF422613) and US1 group (FJ940225), respectively. No contigs representing other plant viruses were identified. A phylogenetic tree of the genomes of 44 isolates encompassing different PepMV strains (Abrahamian et al., 2020) also placed JKT1 in the CH2 clade, and JKT2 in the US1 clade. Leaf samples from 24 randomly selected plants from the same greenhouse were tested by reverse transcription-polymerase chain reaction (RT-PCR) with PepMV-specific primers, Pep3/Pep4 and PepCP-D/PepCP-R (Souiri et al., 2019), yielding products of the expected sizes (625 bp for Pep3/Pep4 and 848 bp for PepCP-D/PepCP-R) from all samples. Amplicons were cloned into the pGEM-T Easy Vector (Promega, USA); two clones for each amplicon were bidirectionally sequenced (BIONEER, Korea) and deposited in GenBank. The 848 bp amplicon (accession no. LC637517) showed 99.65% nt identity to the JKT1 genome (LC656469) and 94.69% identity to a CH2 isolate (JN835466); the 625 bp amplicon (LC637518) had 99.36% nt identity to the JKT2 genome (LC656470) and 97.28% identity to a US1 isolate (FJ940225). Primers specific to the coat protein gene of each isolate (JKT1-F/JKT1-R, CGCTTGCTGGTGCTGTTCAAG/ACGTCTAGACAAAGCAGGGTT, 934 bp; JKT2-F/JKT2-R, CACTAAATGCAGCAGTTTCTG/AGTTTCATTAGCAGCCAGTC, 830 bp) also yielded the expected amplicons from all 24 samples, indicating mixed infections of PepMV strains CH2 and US1. The PCR products from three randomly-selected samples shared 79.93-80.17% nt identity between (JKT1/JKT2) two JKT1-derived sequences (LC683791 and LC683792) and two JKT2-derived sequences (LC683793 and LC683794), further supporting the presence of mixed infections in the samples. To our knowledge, this is the first report of PepMV infecting tomato in South Korea. The virus is carried on tomato seeds (Córdoba-Sellés et al., 2007; Hanssen et al., 2010), and efficiently transmitted by mechanical means leading to rapid spread in tomato crops, and the severe strain CH2 may be a serious threat to tomato production in South Korea. It is important to concentrate on the phytosanitary control for both importation and exportation to manage and prevent further spread of contaminated seeds or infected transplants." @default.
• W4280498976 created "2022-05-22" @default.
• W4280498976 creator A5002185914 @default.
• W4280498976 creator A5005271635 @default.
• W4280498976 creator A5037721578 @default.
• W4280498976 creator A5049182353 @default.
• W4280498976 creator A5058900643 @default.
• W4280498976 date "2023-03-01" @default.
• W4280498976 modified "2023-09-27" @default.
• W4280498976 title "First Report of Pepino Mosaic Virus Infecting Tomato in South Korea" @default.
• W4280498976 cites W1990765095 @default.
• W4280498976 cites W2090903171 @default.
• W4280498976 cites W2955013828 @default.
• W4280498976 cites W2999973680 @default.
• W4280498976 doi "https://doi.org/10.1094/pdis-02-22-0380-pdn" @default.
• W4280498976 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/35536204" @default.
• W4280498976 hasPublicationYear "2023" @default.
• W4280498976 type Work @default.
• W4280498976 citedByCount "0" @default.
• W4280498976 crossrefType "journal-article" @default.
• W4280498976 hasAuthorship W4280498976A5002185914 @default.
• W4280498976 hasAuthorship W4280498976A5005271635 @default.
• W4280498976 hasAuthorship W4280498976A5037721578 @default.
• W4280498976 hasAuthorship W4280498976A5049182353 @default.
• W4280498976 hasAuthorship W4280498976A5058900643 @default.
• W4280498976 hasBestOaLocation W42804989761 @default.
• W4280498976 hasConcept C104317684 @default.
• W4280498976 hasConcept C109110057 @default.
• W4280498976 hasConcept C141231307 @default.
• W4280498976 hasConcept C159047783 @default.
• W4280498976 hasConcept C192953774 @default.
• W4280498976 hasConcept C193252679 @default.
• W4280498976 hasConcept C2522874641 @default.
• W4280498976 hasConcept C2776513250 @default.
• W4280498976 hasConcept C2781083041 @default.
• W4280498976 hasConcept C44465124 @default.
• W4280498976 hasConcept C54355233 @default.
• W4280498976 hasConcept C59582021 @default.
• W4280498976 hasConcept C59822182 @default.
• W4280498976 hasConcept C79029880 @default.
• W4280498976 hasConcept C86803240 @default.
• W4280498976 hasConceptScore W4280498976C104317684 @default.
• W4280498976 hasConceptScore W4280498976C109110057 @default.
• W4280498976 hasConceptScore W4280498976C141231307 @default.
• W4280498976 hasConceptScore W4280498976C159047783 @default.
• W4280498976 hasConceptScore W4280498976C192953774 @default.
• W4280498976 hasConceptScore W4280498976C193252679 @default.
• W4280498976 hasConceptScore W4280498976C2522874641 @default.
• W4280498976 hasConceptScore W4280498976C2776513250 @default.
• W4280498976 hasConceptScore W4280498976C2781083041 @default.
• W4280498976 hasConceptScore W4280498976C44465124 @default.
• W4280498976 hasConceptScore W4280498976C54355233 @default.
• W4280498976 hasConceptScore W4280498976C59582021 @default.
• W4280498976 hasConceptScore W4280498976C59822182 @default.
• W4280498976 hasConceptScore W4280498976C79029880 @default.
• W4280498976 hasConceptScore W4280498976C86803240 @default.
• W4280498976 hasFunder F4320322035 @default.
• W4280498976 hasIssue "3" @default.
• W4280498976 hasLocation W42804989761 @default.
• W4280498976 hasLocation W42804989762 @default.
• W4280498976 hasOpenAccess W4280498976 @default.
• W4280498976 hasPrimaryLocation W42804989761 @default.
• W4280498976 hasRelatedWork W2101970065 @default.
• W4280498976 hasRelatedWork W2208149429 @default.
• W4280498976 hasRelatedWork W2765892609 @default.
• W4280498976 hasRelatedWork W3125995565 @default.
• W4280498976 hasRelatedWork W3176139872 @default.
• W4280498976 hasRelatedWork W3180309927 @default.
• W4280498976 hasRelatedWork W4213125126 @default.
• W4280498976 hasRelatedWork W4280498976 @default.
• W4280498976 hasRelatedWork W4328118218 @default.
• W4280498976 hasRelatedWork W4379966686 @default.
• W4280498976 hasVolume "107" @default.
• W4280498976 isParatext "false" @default.
• W4280498976 isRetracted "false" @default.
• W4280498976 workType "article" @default.