FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W4281620879> ?p ?o ?g. }

• W4281620879 endingPage "292" @default.
• W4281620879 startingPage "280" @default.
• W4281620879 abstract "Erythropoietin (Epo) is produced by a subpopulation of resident fibroblasts in the healthy kidney. We have previously demonstrated that, during kidney fibrosis, kidney fibroblasts including Epo-producing cells transdifferentiate into myofibroblasts and lose their Epo-producing ability. However, it remains unclear whether Epo-producing cells survive and transform into myofibroblasts during fibrosis because previous studies did not specifically label Epo-producing cells in pathophysiological conditions. Here, we generated EpoCreERT2/+ mice, a novel mouse strain that enables labeling of Epo-producing cells at desired time points and examined the behaviors of Epo-producing cells under pathophysiological conditions. Lineage-labeled cells that were producing Epo when labeled were found to be a small subpopulation of fibroblasts located in the interstitium of the kidney, and their number increased during phlebotomy-induced anemia. Around half of lineage-labeled cells expressed Epo mRNA, and this percentage was maintained even 16 weeks after recombination, supporting the idea that a distinct subpopulation of cells with Epo-producing ability makes Epo repeatedly. During fibrosis caused by ureteral obstruction, EpoCreERT2/+-labeled cells were found to transdifferentiate into myofibroblasts with concomitant loss of Epo-producing ability, and their numbers and the proportion among resident fibroblasts increased during fibrosis, indicating their high proliferative capacity. Finally, we confirmed that EpoCreERT2/+-labeled cells that lost their Epo-producing ability during fibrosis regained their ability after kidney repair due to relief of the ureteral obstruction. Thus, our analyses have revealed previously unappreciated characteristic behaviors of Epo-producing cells, which had not been clearly distinguished from those of resident fibroblasts. Erythropoietin (Epo) is produced by a subpopulation of resident fibroblasts in the healthy kidney. We have previously demonstrated that, during kidney fibrosis, kidney fibroblasts including Epo-producing cells transdifferentiate into myofibroblasts and lose their Epo-producing ability. However, it remains unclear whether Epo-producing cells survive and transform into myofibroblasts during fibrosis because previous studies did not specifically label Epo-producing cells in pathophysiological conditions. Here, we generated EpoCreERT2/+ mice, a novel mouse strain that enables labeling of Epo-producing cells at desired time points and examined the behaviors of Epo-producing cells under pathophysiological conditions. Lineage-labeled cells that were producing Epo when labeled were found to be a small subpopulation of fibroblasts located in the interstitium of the kidney, and their number increased during phlebotomy-induced anemia. Around half of lineage-labeled cells expressed Epo mRNA, and this percentage was maintained even 16 weeks after recombination, supporting the idea that a distinct subpopulation of cells with Epo-producing ability makes Epo repeatedly. During fibrosis caused by ureteral obstruction, EpoCreERT2/+-labeled cells were found to transdifferentiate into myofibroblasts with concomitant loss of Epo-producing ability, and their numbers and the proportion among resident fibroblasts increased during fibrosis, indicating their high proliferative capacity. Finally, we confirmed that EpoCreERT2/+-labeled cells that lost their Epo-producing ability during fibrosis regained their ability after kidney repair due to relief of the ureteral obstruction. Thus, our analyses have revealed previously unappreciated characteristic behaviors of Epo-producing cells, which had not been clearly distinguished from those of resident fibroblasts. Translational StatementAlthough we and others showed previously that kidney fibroblasts, including erythropoietin (Epo)-producing cells, transdifferentiate into myofibroblasts in kidney diseases, the behavior of Epo-producing cells remains unclear, because previous studies do not specifically label Epo-producing cells. Here, we generated EpoCreERT2/+ mice to label Epo-producing cells at desired time points and thereby revealed the unique behaviors of Epo-producing cells, such as their sustained Epo-producing ability in healthy kidneys, their loss of Epo-producing ability and rapid proliferation during fibrosis, and their reacquisition of Epo-producing ability after kidney repair. Further analysis of this subpopulation will provide insights that may yield new therapeutic approaches to renal anemia. The hormone erythropoietin (Epo) is essential for erythropoiesis.1Wojchowski D.M. Sathyanarayana P. Dev A. Erythropoietin receptor response circuits.Curr Opin Hematol. 2010; 17: 169-176PubMed Google Scholar In adults, Epo is produced mainly by resident fibroblasts in the kidney and is regulated at transcriptional levels through a hypoxia-inducible factor–dependent mechanism under physiological conditions.2Haase V.H. Hypoxic regulation of erythropoiesis and iron metabolism.Am J Physiol Renal Physiol. 2010; 299: F1-F13Crossref PubMed Scopus (222) Google Scholar, 3Koury M.J. Haase V.H. Anaemia in kidney disease: harnessing hypoxia responses for therapy.Nat Rev Nephrol. 2015; 11: 394-410Crossref PubMed Scopus (179) Google Scholar, 4Obara N. Suzuki N. Kim K. et al.Repression via the GATA box is essential for tissue-specific erythropoietin gene expression.Blood. 2008; 111: 5223-5232Crossref PubMed Scopus (166) Google Scholar, 5Sato Y. Yanagita M. Renal anemia: from incurable to curable.Am J Physiol Renal Physiol. 2013; 305: F1239-F1248Crossref PubMed Scopus (35) Google Scholar Epo-producing cells are distributed mainly in the deep cortex and outer medulla,4Obara N. Suzuki N. Kim K. et al.Repression via the GATA box is essential for tissue-specific erythropoietin gene expression.Blood. 2008; 111: 5223-5232Crossref PubMed Scopus (166) Google Scholar,6Suzuki N. Obara N. Yamamoto M. Use of gene-manipulated mice in the study of erythropoietin gene expression.Methods Enzymol. 2007; 435: 157-177Crossref PubMed Scopus (28) Google Scholar the regions that are physiologically hypoxic and sensitive to subtle changes in oxygen delivery.7Brezis M. Heyman S.N. Dinour D. et al.Role of nitric oxide in renal medullary oxygenation. Studies in isolated and intact rat kidneys.J Clin Invest. 1991; 88: 390-395Crossref PubMed Scopus (234) Google Scholar Under physiological conditions, Epo-producing cells are a small subpopulation of resident fibroblasts detectable around the corticomedullary junctions, whereas under hypoxic conditions, they become detectable in a broader area of the cortex.8Kurtz A. Endocrine functions of the renal interstitium.Pflugers Arch. 2017; 469: 869-876Crossref PubMed Scopus (20) Google Scholar,9Suzuki N. Yamamoto M. Roles of renal erythropoietin-producing (REP) cells in the maintenance of systemic oxygen homeostasis.Pflugers Arch. 2016; 468: 3-12Crossref PubMed Scopus (41) Google Scholar Although the transcriptional regulation of Epo has been analyzed intensively, a remaining unanswered question is whether Epo-producing cells constitute a distinct and specialized subpopulation of resident fibroblasts, or in contrast, all resident fibroblasts possess the capacity to produce Epo. Yamazaki et al. have demonstrated that most resident fibroblasts in the kidneys of inherited super anemic mice (ISAM), which lack Epo-producing ability in the kidneys and are severely anemic, are lineage-labeled with Epo-Cre.10Yamazaki S. Souma T. Hirano I. et al.A mouse model of adult-onset anaemia due to erythropoietin deficiency.Nat Commun. 2013; 4: 1950Crossref PubMed Scopus (53) Google Scholar Although this finding suggests that all kidney fibroblasts have the potential to produce Epo, the lineage-labeled cells in the study are the cells with a history of Epo expression from the developmental period. Indeed, lineage-tracing studies analyzing the cells currently producing Epo in the adult kidneys are lacking, and the behaviors of Epo-producing cells under pathologic conditions also remain unknown. In our previous study, we demonstrated that resident fibroblasts including Epo-producing cells are lineage-labeled with myelin protein zero Cre (P0-Cre), and that, during kidney injury, they transdifferentiate into myofibroblasts and lose their potential to produce Epo, resulting in kidney fibrosis and renal anemia.11Asada N. Takase M. Nakamura J. et al.Dysfunction of fibroblasts of extrarenal origin underlies renal fibrosis and renal anemia in mice.J Clin Invest. 2011; 121: 3981-3990Crossref PubMed Scopus (263) Google Scholar,12Mack M. Yanagita M. Origin of myofibroblasts and cellular events triggering fibrosis.Kidney Int. 2015; 87: 297-307Abstract Full Text Full Text PDF PubMed Scopus (232) Google Scholar We also confirmed that Epo-producing ability can be regained in myofibroblasts by the induction of severe anemia. However, what is not fully clear from our previous study is whether the cells that had been capable of producing Epo in the healthy kidney die, or rather, survive and transdifferentiate into myofibroblasts during kidney fibrosis. This lack of clarity is due to the fact that all kidney fibroblasts, including Epo-producing cells, are labeled in P0-Cre mice in the same way, so we could not trace Epo-producing cells specifically. Previous studies have identified Epo-producing cells by means of in situ hybridization or by using transgenic mice in which green fluorescent protein is knocked-in at the Epo locus.4Obara N. Suzuki N. Kim K. et al.Repression via the GATA box is essential for tissue-specific erythropoietin gene expression.Blood. 2008; 111: 5223-5232Crossref PubMed Scopus (166) Google Scholar,13Koury S.T. Bondurant M.C. Koury M.J. Localization of erythropoietin synthesizing cells in murine kidneys by in situ hybridization.Blood. 1988; 71: 524-527Crossref PubMed Google Scholar,14Lacombe C. Da Silva J.L. Bruneval P. et al.Peritubular cells are the site of erythropoietin synthesis in the murine hypoxic kidney.J Clin Invest. 1988; 81: 620-623Crossref PubMed Scopus (358) Google Scholar Therefore, Epo-producing cells could not be observed in the kidneys with impaired Epo-producing ability, and the behavior of Epo-producing cells could not be monitored while Epo production was paused. In the present study, to address these problems, we established EpoCreERT2/+ mice, a novel mouse line that allows us to label Epo-producing cells at desired time points and to trace Epo-producing cells even while Epo production is paused. Utilizing this novel mouse line, we traced the fate of Epo-producing cells under physiological and pathologic conditions and identified Epo-producing cells as being a distinct subpopulation of resident fibroblasts with unique phenotypes. All animal studies were approved by the Animal Research Committee, Kyoto University Graduate School of Medicine, and the Institutional Animal Care and Use Committee of the RIKEN Center for Biosystems Dynamic Research, Kobe branch, and performed in accordance with the guidelines of Kyoto University and the RIKEN Kobe branch, as well as US National Institutes of Health guidelines. To construct a targeting vector, genomic fragments containing the mouse Epo gene were isolated from a bacterial artificial chromosome (BAC) clone (RP23-129L22, BACPAC Resources). We inserted a CreERT2 cassette (Artemis Pharmaceuticals), polyA tail, and a FRT-flanked PGK-Neo cassette into the Epo ATG start site of exon 1 (Figure 1a). TT2 embryonic stem (ES) cells were electroporated with targeting vector.15Yagi T. Tokunaga T. Furuta Y. et al.A novel ES cell line, TT2, with high germline-differentiating potency.Anal Biochem. 1993; 214: 70-76Crossref PubMed Scopus (419) Google Scholar G418-resistant ES colonies were selected, and correctly targeted clones were identified by Southern blotting (Figure 1b). Two clones of ES cells (#21 and #55) were injected into 8-cell stage embryos to obtain mouse chimeras, which were crossed with wild-type C57BL/6J mice for germline transmission. Correct targeting was also confirmed by genomic polymerase chain reaction (PCR) of the tail genome (Figure 1c). Primers utilized were as follows: primer A: CTACAGAACTTCCAAGGATG; primer B: ACTTCTCGGCCAAACTTCAC; primer C: CTCGACCAGTTTAGTTACCC. EpoCreERT2/+ mice (Accession No. CDB1003K: http://www2.clst.riken.jp/arg/mutant%20mice%20list.html) were backcrossed to C57BL/6J mice at least 7 times. The EpoCreERT2/+ mouse strain can be used by other researchers, subject to agreement with the corresponding author on terms and conditions of use. A detailed description is provided in the Supplementary Full Methods of protocols used for the following: (i) animals; (ii) anemia induction and the administration of tamoxifen; (iii) kidney injury models; (iv) immunostaining; (v) in situ hybridization; (vi) quantitative assessment; (vii) real-time reverse transcription quantitative (RT-q) PCR analysis; (viii) enzyme-linked immunosorbent assay (ELISA); and (ix) statistical analysis. To generate Epo-producing cell-specific inducible Cre mice, we generated an EpoCreERT2/+ knock-in allele with the CreERT2 cassette introduced into the Epo locus at the position of the initiation codon (Figure 1a). ES clones were tested for correct recombination by Southern blotting (Figure 1b), and correctly targeted ES cells were injected into blastocysts to obtain mouse chimeras. Chimeras were mated with C57BL/6J mice to obtain an N1 generation. Correct recombination was also confirmed by PCR of the tail genome (Figure 1c). The knock-in allele disrupted the first exon, thereby deleting the expression of Epo. Although no EpoCreERT2/CreERT2 mouse was born from the mating between EpoCreERT2/+ mice, in agreement with the previous report showing that Epo knockout mice are embryonically lethal,16Wu H. Liu X. Jaenisch R. et al.Generation of committed erythroid BFU-E and CFU-E progenitors does not require erythropoietin or the erythropoietin receptor.Cell. 1995; 83: 59-67Abstract Full Text PDF PubMed Scopus (851) Google Scholar EpoCreERT2/+ and Epo+/+ littermates were obtained in the predicted ratios (Table 1). Body weight (Bw), hemoglobin (Hb), hematocrit (Hct; Figure 1d and e), and Epo mRNA expression in the kidney and cerebrum (Figure 1f) were comparable between EpoCreERT2/+ mice and wild-type littermates, although the expression levels in these tissues were significantly lower compared to those in anemic kidneys (Figure 1f). High-sensitivity in situ hybridization using RNAscope detected very few Epo mRNA–expressing cells in the kidney and did not detect any Epo mRNA–expressing cells in the cerebrum of either genotype in non-anemic conditions (Supplementary Figure S1). Next, we assessed whether there was a difference in Epo responsiveness to anemia between wild-type and EpoCreERT2/+ mice, and found that the Epo reactivity to anemia was attenuated in EpoCreERT2/+ mice, probably due to heterozygous deletion of the Epo gene (Figure 1g). However, Epo mRNA expression and serum EPO concentration increased with the severity of anemia.Table 1Number and percentage of pups in each genotypeN/%EpoCreERT2/CreERT2EpoCreERT2/+Epo+/+TotalNumber of pups0441963%069.830.2100 Open table in a new tab To analyze the specificity and efficiency of Cre recombination, we bred EpoCreERT2/+ mice with Rosa26-tdTomato (R26tdTomato) indicator mice, in which tdTomato is expressed after Cre-mediated recombination of the loxP-flanked stop sequence, and administered tamoxifen to EpoCreERT2/+:R26tdTomato mice to induce this recombination (Figure 2a). To enhance Epo expression, we induced anemia by phlebotomy during tamoxifen administration. Although very few tdTomato-expressing cells (tdTomato+ cells) existed in the kidney without anemia induction (Figure 2b), the number of tdTomato+ cells increased in parallel with the severity of anemia and Epo mRNA expression in the kidney (Figure 2b and c). tdTomato+ cells in severely anemic mice were located mainly in the corticomedullary region, where they formed clusters (Figure 2d). Epo mRNA-expressing cells were also observed by high-sensitivity in situ hybridization in the corticomedullary region, where they formed clusters similar to those of tdTomato+ cells (Supplementary Figure S2). To exclude the possibility of spontaneous recombination, 3 EpoCreERT2/+:R26tdTomato mice were vehicle-treated with anemia induction, and 3 slice sections of the kidney per mouse were examined. In the kidneys, tdTomato+ cells were present at 0.09 ± 0.19/mm2, whereas tdTomato+ cells in tamoxifen-administered EpoCreERT2/+:R26tdTomato mice with the same volume of bleeding were present at 22.9 ± 8.9/mm2 (data of 4 samples shown in Figure 2c), indicating that the spontaneous recombination of EpoCreERT2/+ was very limited (Supplementary Figure S3). Immunostaining of tdTomato+ cells showed that these cells were located in the interstitium and that they expressed platelet-derived growth factor receptor beta (PDGFRβ) and CD73, indicating that tdTomato+ cells were resident fibroblasts (Figure 2e). tdTomato+ cells did not express CD31, an endothelial cell marker, or CD45, a common leucocyte antigen (Figure 2e). Occasional recombination was also observed in a small number of cells in the glomeruli and collecting ducts (Supplementary Figure S4). To confirm that Epo-producing cells were accurately labeled in EpoCreERT2/+ mice, we performed high-sensitivity double in situ hybridization for Epo mRNA and Cre mRNA, and found that 84.3% ± 16.4% of Cre mRNA-expressing cells expressed Epo mRNA (Figure 2f–h; Table 2). The proportion of Cre mRNA–expressing cells in Epo-producing cells was 6.5% ± 3.6%, and the number of Cre mRNA–expressing cells and tdTomato mRNA–expressing cells was low compared with the number of Epo mRNA–expressing cells (Tables 2 and 3; Supplementary Figure S5), indicating the relatively low recombination efficiency of EpoCreERT2/+ mice. Taken together, these findings clearly show the following characteristic features of lineage-labeled cells in EpoCreERT2/+ mice: (i) EpoCreERT2/+-labeled cells were fibroblasts in the corticomedullary interstitium, as previously reported4Obara N. Suzuki N. Kim K. et al.Repression via the GATA box is essential for tissue-specific erythropoietin gene expression.Blood. 2008; 111: 5223-5232Crossref PubMed Scopus (166) Google Scholar,17Bachmann S. Le Hir M. Eckardt K.U. Co-localization of erythropoietin mRNA and ecto-5'-nucleotidase immunoreactivity in peritubular cells of rat renal cortex indicates that fibroblasts produce erythropoietin.J Histochem Cytochem. 1993; 41: 335-341Crossref PubMed Scopus (305) Google Scholar; (ii) anemia induction increased the number of EpoCreERT2/+-labeled cells; and (iii) most Cre mRNA–expressing cells in EpoCreERT2/+ mice expressed Epo mRNA.Table 2Number and proportion of Epo-producing cells and Cre mRNA–expressing cells 48 hours after the first administration of tamoxifenCellsNumber and proportionEpo-producing cells66.0 ± 24.9Cre mRNA–expressing cells6.4 ± 4.7Coexpressing cells5.0 ± 3.6Epo-producing cells in Cre mRNA–expressing cells, %84.3 ± 16.4Cre mRNA–expressing cells in Epo-producing cells, %6.5 ± 3.6Epo, erythropoietin.Units are number/mm2, except proportions, which are specified as %. Data are given as mean ± SD. Open table in a new tab Table 3Number and proportion of Epo-producing cells and tdTomato mRNA–expressing cells 48 hours, 5 weeks, and 16 weeks after the first administration of tamoxifenCellsAnalysis with anemiaAnalysis without anemia48 h5 wk16 wk5 wk16 wkEpo-producing cells58.5 ± 29.159.2 ± 12.571.7 ± 18.24.7 ± 3.89.0 ± 4.9tdTomato mRNA–expressing cells10.8 ± 5.814.0 ± 3.517.0 ± 1.613.7 ± 5.623.8 ± 15.9Coexpressing cells, number/mm26.2 ± 4.17.1 ± 2.18.1 ± 3.00.2 ± 0.31.4 ± 1.3Epo-producing cells in tdTomato mRNA–expressing cells, %56.7 ± 15.751.0 ± 11.847.3 ± 14.33.3 ± 4.75.4 ± 3.6tdTomato mRNA–expressing cells in Epo-producing cells, %10.7 ± 2.912.1 ± 3.711.7 ± 3.931.2 ± 47.312.8 ± 10.3Epo, erythropoietin.Units are number/mm2, except proportions, which are specified as %. Data are given as mean ± SD. Open table in a new tab Epo, erythropoietin. Units are number/mm2, except proportions, which are specified as %. Data are given as mean ± SD. Epo, erythropoietin. Units are number/mm2, except proportions, which are specified as %. Data are given as mean ± SD. Next, we examined whether the same subpopulation of fibroblasts repeatedly produces Epo over a long period upon ischemia of their microenvironment, or rather whether different subpopulations of fibroblasts produce Epo stochastically at different time points (Figure 3a). We administered tamoxifen to 4-week-old EpoCreERT2/+:R26tdTomato mice, and euthanized them at various time points after anemia induction (48 hours, 5 weeks, or 16 weeks after the first tamoxifen administration; Figure 3b, upper illustration). The Hct levels at each time point were 27.1 ± 2.0%, 21.5 ± 1.6%, and 22.6 ± 3.1%, respectively. A slightly milder anemia was induced for analysis at 48 hours, to prevent death due to simultaneous administration of tamoxifen, and because the mice were small at 4 weeks of age. We performed high-sensitivity double in situ hybridization for Epo mRNA and tdTomato mRNA, and found that 56.7% ± 15.7% of tdTomato mRNA–expressing cells expressed Epo mRNA (Figure 3c and d; Table 3), whereas 10.7% ± 2.9% of Epo mRNA–expressing cells were positive for tdTomato mRNA 48 hours after the first tamoxifen administration. Interestingly, about 50% of tdTomato mRNA–expressing cells maintained the ability to produce Epo for as long as 16 weeks: the proportions of Epo-producing cells among the tdTomato mRNA–expressing cells were 56.7% ± 15.7%, 51.0% ± 11.8%, and 47.3% ± 14.3% at 48 hours, 5 weeks, and 16 weeks, respectively (Figure 3c and d). There was no significant difference among these 3 time points (P = 0.65 by analysis of variance). These results support “hypothesis 1” that there exists a certain subpopulation among resident fibroblasts that repeatedly produces Epo in response to anemic conditions (Figure 3a). We also examined the proportion of Epo-producing cells among tdTomato+ cells without anemia induction at 5 weeks and at16 weeks after the tamoxifen administration (Figure 3b, lower illustration), and the averages, respectively, were 3.3% ± 4.7% and 5.4% ± 3.6% (Figure 3d). We further investigated the behaviors of Epo-producing cells during kidney injury utilizing the unilateral ureteral obstruction (UUO) model. To exclude the effects of tamoxifen administration and anemia, we performed UUO 5 weeks after the administration of tamoxifen and phlebotomy (Figure 4a). tdTomato+ cells were a rare population before injury, and their number was 47.9 ± 23.6/mm2, and the proportion of tdTomato+ cells to PDGFRβ-positive fibroblasts in the inner cortex was 1.9% ± 0.8% (Figure 4b, d, e; Table 4). Three days after UUO, the number of tdTomato+ cells increased dramatically (Figure 4b). The number of tdTomato+ cells per high-power field was 324.4 ± 103.0/mm2 3 days after UUO (Figure 4d), and the proportion of tdTomato+ cells to PDGFRβ-positive fibroblasts had increased 4.8-fold (1.9% ± 0.8% before injury, and 9.2% ± 2.4% after UUO; Figure 4e). Additionally, 2 days after UUO, the proportion of Ki67+ cells among tdTomato+ cells (12.7% ± 1.7%) was significantly higher than that among PDGFRβ-positive fibroblasts without tdTomato expression (8.1% ± 1.6%; Figure 4f; Supplementary Figure S6). These results indicate that tdTomato+ cells had a high capacity to proliferate during fibrosis. Although tdTomato+ cells in healthy kidneys expressed PDGFRβ, but not alpha smooth muscle actin (α-SMA; a marker of myofibroblasts), 73.4% ± 9.2% of tdTomato+ cells began to express α -SMA after UUO, indicating their transdifferentiation into myofibroblasts (Figure 4c and g). The proportions of myofibroblasts in tdTomato+ cells and in PDGFRβ-positive fibroblasts without tdTomato expression were comparable (Figure 4h; the data of tdTomato+ cells shown in Figure 4h are the same data shown in Figure 4g), indicating that EpoCreERT2-labeled cells transdifferentiated into myofibroblasts at the same rate as other fibroblasts.Table 4Number and proportion of tdTomato+ cells, PDGFRβ-positive cells, αSMA–positive cells, and Ki67+ cells during UUO experimentCellsNTUUO, day 2UUO, day 3tdTomato-positive cells47.9 ± 23.6114.8 ± 17.2324.4 ± 103.0α-SMA-positive cells124.6 ± 35.2n.d.2862.1 ± 409.9PDGFRβ-positive cells2410.4 ± 205.23161.3 ± 254.83462.9 ± 215.1PDGFRβ-positive tdTomato+ cells46.3 ± 21.6106.6 ± 21.2293.8 ± 98.7PDGFRβ-positive tdTomato- cells2364.1 ± 191.03054.6 ± 276.13169.1 ± 122.8tdTomato+ cells in PDGFRβ-positive fibroblasts, %1.9 ± 0.83.6 ± 0.89.2 ± 2.4α-SMA-positive myofibroblasts in tdTomato+ cells, %1.6 ± 2.0n.d.73.4 ± 9.2α-SMA-positive myofibroblasts in PDGFRβ-positive tdTomato- fibroblasts, %1.9 ± 0.8n.d.69.6 ± 9.4Ki67+ cells in PDGFRβ-positive tdTomato+ fibroblastsn.d.12.9 ± 4.9n.d.Ki67+ cells in PDGFRβ-positive tdTomato- fibroblastsn.d.247.2 ± 32.9n.d.Ki67+ cells in PDGFRβ-positive tdTomato+ fibroblasts, %n.d.12.7 ± 1.7n.d.Ki67+ cells in PDGFRβ-positive tdTomato- fibroblasts, %n.d.8.1 ± 1.6n.d.αSMA, alpha smooth muscle actin; n.d., not determined; NT, not treated; PDGFRβ, platelet-derived growth factor receptor beta; UUO, unilateral ureteral obstruction.Units are number/mm2, except proportions, which are specified as %. Data are given as mean ± SD. Open table in a new tab αSMA, alpha smooth muscle actin; n.d., not determined; NT, not treated; PDGFRβ, platelet-derived growth factor receptor beta; UUO, unilateral ureteral obstruction. Units are number/mm2, except proportions, which are specified as %. Data are given as mean ± SD. A significant increase in the number of tdTomato+ cells was also observed in other models of kidney injury, ischemic reperfusion injury, and folic acid nephropathy (Figure 4i). Additionally, most of the tdTomato+ cells in these models expressed α-SMA, indicating their transdifferentiation into myofibroblasts (Figure 4j). Next, we examined whether tdTomato+ cells are able to produce Epo after transdifferentiation into myofibroblasts 14 days after UUO. Even under anemic conditions, when about 43.4% ± 10.7% of tdTomato mRNA–expressing cells in the contralateral kidney expressed Epo mRNA, only 2.2% ± 3.9% of tdTomato mRNA–expressing cells in the diseased kidney expressed Epo mRNA, and the proportion of Epo-producing cells among tdTomato mRNA–expressing cells was significantly reduced (Figure 5a and b; Table 5). These results show that most tdTomato mRNA–expressing cells lost their Epo-producing ability after transdifferentiation into myofibroblasts.Table 5Number and proportion of Epo-producing cells and tdTomato mRNA–expressing cells 14 days after UUO with anemia inductionCellsContralateralDiseasedEpo-producing cells90.6 ± 57.31.9 ± 3.2tdTomato mRNA-expressing cells25.9 ± 6.846.1 ± 21.7Coexpressing cells11.6 ± 5.70.5 ± 0.9Epo-producing cells in tdTomato mRNA–expressing cells, %43.4 ± 10.72.2 ± 3.9tdTomato mRNA–expressing cells in Epo-producing cells, %13.7 ± 3.310.0 ± 17.3Epo, erythropoietin; UUO, unilateral ureteral obstruction.Units are number/mm2, except proportions, which are specified as %. Data are given as mean ± SD. Open table in a new tab Epo, erythropoietin; UUO, unilateral ureteral obstruction. Units are number/mm2, except proportions, which are specified as %. Data are given as mean ± SD. Finally, we examined whether tdTomato mRNA–expressing cells have the capacity to restore Epo-producing ability when kidney injury is repaired. We utilized a reversible UUO model, in which a vascular clip was used for ureter obstruction instead of ureter ligation, and hydronephrosis would be reversed by clip removal 3 days after UUO. Because the anemia induction protocol of 5 bleedings would result in minimal hydronephrosis due to dehydration, we changed the anemia-induction protocol in this model—instead, mice underwent a single bleeding followed by peritoneal injection of the same amount of saline (Figure 6a). We performed analysis at 3 time points, with anemia induced by a single bleeding—before injury (non-treat; NT), 3 days after ureteral obstruction by the clip (Injury), and 14 days after clip removal (Repaired). The numbers of Epo-producing cells and the proportions of Epo-producing cells among tdTomato mRNA–expressing cells decreased from 57.4 ± 12.8/mm2 to 7.0 ± 3.6/mm2, and 19.0% ± 7.8% to 2.6% ± 0.6%, 3 days after ureter obstruction, but rebounded 14 days after clip removal to 49.8 ± 2.4/mm2 and 20.1% ± 6.0%, respectively (Figure 6b and c; Table 6). The Hct levels were 31.1 ± 1.6% in the NT group, 34.1 ± 2.0% in the Injury group, and 28.6 ± 2.6% in the Repaired group (Figure 6d), and there was no significant difference between the NT and Repaired groups. The number of tdTomato mRNA–expressing cells was increased in the Injury group, possibly due to proliferation, but also returned to the basal levels in the Repaired group (Figure 6c). These results show that tdTomato mRNA–expressing cells lose Epo-producing ability during kidney injury but regain Epo-producing ability after kidney repair.Table 6Number and proportion of Epo-producing cells and tdTomato mRNA–expressing cells in reversible UUOCellsNTInjuryRepairedEpo-producing cells57.4 ± 12.87.0 ± 3.649.8 ± 2.4tdTomato mRNA–expressing cells22.8 ± 6.337.8 ± 9.919.5 ± 4.5Coexpressing cells4.2 ± 1.91.0 ± 0.24.1 ± 2.0Epo-producing cells in tdTomato mRNA–expressing cells, %19.0 ± 7.82.6 ± 0.620.1 ± 6.0tdTomato mRNA–expressing cells in Epo-producing cells, %7.7 ± 4.017.5 ± 11.88.3 ± 4.0Epo, erythropoietin; NT, not treated; UUO, unilateral" @default.
• W4281620879 created "2022-06-13" @default.
• W4281620879 creator A5014838749 @default.
• W4281620879 creator A5022665278 @default.
• W4281620879 creator A5027201625 @default.
• W4281620879 creator A5034949085 @default.
• W4281620879 creator A5038504434 @default.
• W4281620879 creator A5053240410 @default.
• W4281620879 creator A5057534039 @default.
• W4281620879 creator A5084084651 @default.
• W4281620879 creator A5085413862 @default.
• W4281620879 date "2022-08-01" @default.
• W4281620879 modified "2023-10-18" @default.
• W4281620879 title "Lineage tracing analysis defines erythropoietin-producing cells as a distinct subpopulation of resident fibroblasts with unique behaviors" @default.
• W4281620879 cites W1528664908 @default.
• W4281620879 cites W1573068714 @default.
• W4281620879 cites W1863571823 @default.
• W4281620879 cites W1893364029 @default.
• W4281620879 cites W2053071361 @default.
• W4281620879 cites W2064918807 @default.
• W4281620879 cites W2084758702 @default.
• W4281620879 cites W2088988158 @default.
• W4281620879 cites W2111901036 @default.
• W4281620879 cites W2129122050 @default.
• W4281620879 cites W2136732413 @default.
• W4281620879 cites W2137333423 @default.
• W4281620879 cites W2137584496 @default.
• W4281620879 cites W2144795074 @default.
• W4281620879 cites W2156998972 @default.
• W4281620879 cites W2157705760 @default.
• W4281620879 cites W2159511914 @default.
• W4281620879 cites W2165347564 @default.
• W4281620879 cites W2178101235 @default.
• W4281620879 cites W2337899633 @default.
• W4281620879 cites W2464261159 @default.
• W4281620879 cites W2610441235 @default.
• W4281620879 cites W2625097944 @default.
• W4281620879 cites W2704386052 @default.
• W4281620879 cites W2903354687 @default.
• W4281620879 cites W2963534431 @default.
• W4281620879 cites W2964045421 @default.
• W4281620879 cites W3028477446 @default.
• W4281620879 cites W3032766622 @default.
• W4281620879 cites W3133727778 @default.
• W4281620879 cites W3155331209 @default.
• W4281620879 doi "https://doi.org/10.1016/j.kint.2022.04.026" @default.
• W4281620879 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/35644281" @default.
• W4281620879 hasPublicationYear "2022" @default.
• W4281620879 type Work @default.
• W4281620879 citedByCount "6" @default.
• W4281620879 countsByYear W42816208792022 @default.
• W4281620879 countsByYear W42816208792023 @default.
• W4281620879 crossrefType "journal-article" @default.
• W4281620879 hasAuthorship W4281620879A5014838749 @default.
• W4281620879 hasAuthorship W4281620879A5022665278 @default.
• W4281620879 hasAuthorship W4281620879A5027201625 @default.
• W4281620879 hasAuthorship W4281620879A5034949085 @default.
• W4281620879 hasAuthorship W4281620879A5038504434 @default.
• W4281620879 hasAuthorship W4281620879A5053240410 @default.
• W4281620879 hasAuthorship W4281620879A5057534039 @default.
• W4281620879 hasAuthorship W4281620879A5084084651 @default.
• W4281620879 hasAuthorship W4281620879A5085413862 @default.
• W4281620879 hasBestOaLocation W42816208791 @default.
• W4281620879 hasConcept C104317684 @default.
• W4281620879 hasConcept C2776817793 @default.
• W4281620879 hasConcept C2778534260 @default.
• W4281620879 hasConcept C54355233 @default.
• W4281620879 hasConcept C70721500 @default.
• W4281620879 hasConcept C71924100 @default.
• W4281620879 hasConcept C86803240 @default.
• W4281620879 hasConcept C95444343 @default.
• W4281620879 hasConceptScore W4281620879C104317684 @default.
• W4281620879 hasConceptScore W4281620879C2776817793 @default.
• W4281620879 hasConceptScore W4281620879C2778534260 @default.
• W4281620879 hasConceptScore W4281620879C54355233 @default.
• W4281620879 hasConceptScore W4281620879C70721500 @default.
• W4281620879 hasConceptScore W4281620879C71924100 @default.
• W4281620879 hasConceptScore W4281620879C86803240 @default.
• W4281620879 hasConceptScore W4281620879C95444343 @default.
• W4281620879 hasFunder F4320309807 @default.
• W4281620879 hasFunder F4320310657 @default.
• W4281620879 hasFunder F4320310760 @default.
• W4281620879 hasFunder F4320311405 @default.
• W4281620879 hasFunder F4320320912 @default.
• W4281620879 hasFunder F4320334764 @default.
• W4281620879 hasIssue "2" @default.
• W4281620879 hasLocation W42816208791 @default.
• W4281620879 hasLocation W42816208792 @default.
• W4281620879 hasLocation W42816208793 @default.
• W4281620879 hasLocation W42816208794 @default.
• W4281620879 hasOpenAccess W4281620879 @default.
• W4281620879 hasPrimaryLocation W42816208791 @default.
• W4281620879 hasRelatedWork W1641042124 @default.
• W4281620879 hasRelatedWork W1990804418 @default.
• W4281620879 hasRelatedWork W1993764875 @default.
• W4281620879 hasRelatedWork W2013243191 @default.
• W4281620879 hasRelatedWork W2051339581 @default.
• W4281620879 hasRelatedWork W2082860237 @default.

• next