FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W4284690215> ?p ?o ?g. }

• W4284690215 endingPage "592" @default.
• W4284690215 startingPage "592" @default.
• W4284690215 abstract "Grapevine-associated tymo-like virus (GaTLV) was reported to infect several grapevine cultivars in France (Hily et al. 2018). Recently, GaTLV-specific reads were identified among high-throughput sequencing (HTS) outputs from a pooled sample of grapevines in Tennessee, but the virus presence in individual plants was not confirmed by the RT-PCR testing with specific primers (Hu et al. 2021). In Idaho, several viruses infect wine grapes, such as grapevine leafroll-associated virus 3 (GLRaV-3; Mekuria et al. 2009; Thompson et al. 2019a), grapevine fleck virus (Kanuya et al. 2012), grapevine red blotch virus (Thompson et al. 2019b), and grapevine rupestris vein feathering virus (Dahan et al. 2021), while GaTLV status was not tested for previously. In September 2020 leaf and petiole samples of six different cultivars were collected from six vineyards in Canyon and Nez Perce counties of Idaho, for a total of 16 samples. Most of the samples were selected based on symptoms of vine decline, grapevine leafroll disease (GLD), or other abnormalities. Ribodepleted total RNAs prepared from these samples as described previously (Thompson et al. 2019a) were subjected to a HTS analysis on a NovaSeq platform, producing between 15,095,042 and 31,500,611 250-bp paired-end reads per sample. Raw reads were adapter and quality cleaned and mapped against the Vitis vinifera L., reference genome. Unmapped paired-end reads were assembled, and contigs were analyzed using BLASTn and DIAMOND (Buchfink et al. 2021) programs. Three of the samples, two collected from own-rooted Chardonnay vines planted in 1981, and one from an own-rooted, 20-yr old Cabernet franc vine, yielded large, 6,005 to 6,024-nt contigs exhibiting 99.0% identity to the sequence of the GaTLV (MH383239) described in France (Hily et al. 2018). Conceivably, these 6,005 to 6,024-nt sequences represented nearly complete genomes of the Idaho isolates of GaTLV; they were designated GaTLV-ID1 to -ID3 and deposited in the GenBank database under the accession numbers ON853767-ON853769. Two specific primer pairs, GaT1_2009F (5'-GGCTGAGTTAAAGGACGAGAA-3') and GaT1_2648R (5'-CGCCACGCCAAGCCAATAATGCT - 3'), and GaT2_5499F (5' - GCCAGAGTTTTCGGAGGCAAA - 3') and GaT2_5905R (5'-CGCGGAAAAACAATTCAGCAA-3') amplifying 662-bp and 427-bp products, respectively, were used to test for GaTLV presence in these 2020 samples, and also in additional 18 samples collected in September 2021 from nine grapevine cultivars in three vineyards of Canyon County, Idaho. Twelve GaTLV-positive samples, out of the 34 total, were identified in five out of the seven tested vineyards located in Canyon and Nez Perce counties of Idaho (Supplementary Fig. S1), in Chardonnay (nine positives), Gewürztraminer (one positive), Cabernet franc (one positive), and an unknown cultivar (one positive). The two RT-PCR products were Sanger sequenced for ten GaTLV-positives and displayed 100% identity to the HTS-derived GaTLV-ID genomic sequences at the targeted regions. The exact role of GaTLV in the development of the symptoms of decline in Chardonnay or in GLD symptoms in Cabernet franc vines is not clear at the moment. These same Chardonnay and Gewürztraminer samples contained other GLD-associated viruses, such as GLRaV-3 (Dahan et al. 2021), while the GaTLV-positive Cabernet franc had only common viroids, hop stunt viroid and grapevine yellow speckle viroid 1, not normally associated with GLD symptoms in wine grapes (Di Serio et al. 2017). To the best of our knowledge, this is the first report of GaTLV in Idaho, and, given the lack of RT-PCR amplifications of GaTLV sequences reported by Hu et al. (2021), also the first confirmed report of GaTLV presence in wine grapes in the United States." @default.
• W4284690215 created "2022-07-08" @default.
• W4284690215 creator A5035694388 @default.
• W4284690215 creator A5059051153 @default.
• W4284690215 creator A5059375996 @default.
• W4284690215 creator A5068145977 @default.
• W4284690215 date "2023-02-01" @default.
• W4284690215 modified "2023-09-30" @default.
• W4284690215 title "Occurrence of Grapevine-Associated Tymo-Like Virus in Wine Grapes in the United States" @default.
• W4284690215 cites W2038127375 @default.
• W4284690215 cites W2044803897 @default.
• W4284690215 cites W2889377547 @default.
• W4284690215 cites W2890835843 @default.
• W4284690215 cites W2946251379 @default.
• W4284690215 cites W3128052524 @default.
• W4284690215 cites W3143063265 @default.
• W4284690215 cites W3157602617 @default.
• W4284690215 doi "https://doi.org/10.1094/pdis-05-22-1140-pdn" @default.
• W4284690215 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/35793157" @default.
• W4284690215 hasPublicationYear "2023" @default.
• W4284690215 type Work @default.
• W4284690215 citedByCount "3" @default.
• W4284690215 countsByYear W42846902152023 @default.
• W4284690215 crossrefType "journal-article" @default.
• W4284690215 hasAuthorship W4284690215A5035694388 @default.
• W4284690215 hasAuthorship W4284690215A5059051153 @default.
• W4284690215 hasAuthorship W4284690215A5059375996 @default.
• W4284690215 hasAuthorship W4284690215A5068145977 @default.
• W4284690215 hasConcept C109110057 @default.
• W4284690215 hasConcept C144027150 @default.
• W4284690215 hasConcept C159047783 @default.
• W4284690215 hasConcept C197321923 @default.
• W4284690215 hasConcept C2522874641 @default.
• W4284690215 hasConcept C2779513598 @default.
• W4284690215 hasConcept C2780287141 @default.
• W4284690215 hasConcept C2780619479 @default.
• W4284690215 hasConcept C2780653484 @default.
• W4284690215 hasConcept C2780924976 @default.
• W4284690215 hasConcept C2781214258 @default.
• W4284690215 hasConcept C2992143071 @default.
• W4284690215 hasConcept C2994243853 @default.
• W4284690215 hasConcept C59822182 @default.
• W4284690215 hasConcept C86803240 @default.
• W4284690215 hasConceptScore W4284690215C109110057 @default.
• W4284690215 hasConceptScore W4284690215C144027150 @default.
• W4284690215 hasConceptScore W4284690215C159047783 @default.
• W4284690215 hasConceptScore W4284690215C197321923 @default.
• W4284690215 hasConceptScore W4284690215C2522874641 @default.
• W4284690215 hasConceptScore W4284690215C2779513598 @default.
• W4284690215 hasConceptScore W4284690215C2780287141 @default.
• W4284690215 hasConceptScore W4284690215C2780619479 @default.
• W4284690215 hasConceptScore W4284690215C2780653484 @default.
• W4284690215 hasConceptScore W4284690215C2780924976 @default.
• W4284690215 hasConceptScore W4284690215C2781214258 @default.
• W4284690215 hasConceptScore W4284690215C2992143071 @default.
• W4284690215 hasConceptScore W4284690215C2994243853 @default.
• W4284690215 hasConceptScore W4284690215C59822182 @default.
• W4284690215 hasConceptScore W4284690215C86803240 @default.
• W4284690215 hasIssue "2" @default.
• W4284690215 hasLocation W42846902151 @default.
• W4284690215 hasLocation W42846902152 @default.
• W4284690215 hasOpenAccess W4284690215 @default.
• W4284690215 hasPrimaryLocation W42846902151 @default.
• W4284690215 hasRelatedWork W2094936993 @default.
• W4284690215 hasRelatedWork W2155367094 @default.
• W4284690215 hasRelatedWork W2181478597 @default.
• W4284690215 hasRelatedWork W2757521269 @default.
• W4284690215 hasRelatedWork W2792915002 @default.
• W4284690215 hasRelatedWork W2948414908 @default.
• W4284690215 hasRelatedWork W3098288334 @default.
• W4284690215 hasRelatedWork W3141350065 @default.
• W4284690215 hasRelatedWork W4284690215 @default.
• W4284690215 hasRelatedWork W935838289 @default.
• W4284690215 hasVolume "107" @default.
• W4284690215 isParatext "false" @default.
• W4284690215 isRetracted "false" @default.
• W4284690215 workType "article" @default.