FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W4294631412> ?p ?o ?g. }

• W4294631412 endingPage "4057" @default.
• W4294631412 startingPage "4056" @default.
• W4294631412 abstract "Transboundary and Emerging DiseasesEarly View CORRIGENDUMFree Access This article corrects the following: Brucellosis re-emergence after a decade of quiescence in Palestine, 2015–2017: A seroprevalence and molecular characterization study Bessan Aljanazreh, Khaled Alzatari, Asmaa Tamimi, Mohammad H. Alsaafeen, Waheed Hassouneh, Yaqoub Ashhab, Volume 69Issue 4Transboundary and Emerging Diseases pages: e130-e140 First Published online: August 14, 2021 First published: 05 September 2022 https://doi.org/10.1111/tbed.14690AboutSectionsPDF ToolsRequest permissionExport citationAdd to favoritesTrack citation ShareShare Give accessShare full text accessShare full-text accessPlease review our Terms and Conditions of Use and check box below to share full-text version of article.I have read and accept the Wiley Online Library Terms and Conditions of UseShareable LinkUse the link below to share a full-text version of this article with your friends and colleagues. Learn more.Copy URL Share a linkShare onFacebookTwitterLinked InRedditWechat In the article by Aljanazreh et al. (2022), the MLVA primers were duplicated, and the reference style was incorrect in Table S1. The correct table is shown below (Table A1). TABLE A1. Molecular techniques Target Product size (bp) Sequence 5′-> 3′ Reference Genus Identification bcsp31, B4 223 5′-TGGCTCGGTTGCCAATATCAA-3′ [Baily et al., 1992] bcsp31, B5 5′-CGCGCTTGCCTTTCAGGTCTG-3′ Species Identification B. abortus F 136 5′-GCGGCTTTTCTATCACGGTATTC-3′ This study B. abortus R 5′-CATGCGCTATGATCTGGTTACG-3′ based on B. melitensis F 279 5′-AACAAGCGGCACCCCTAAAA-3′ Reference B. melitensis R 5′-CATGCGCTATGATCTGGTTACG-3′ [Probert et al.,2004] Identification of Rev.1 Rpsl gene, A 510 5′-GAGGGCTGACTCCGAATTTG-3′ [Cloeckaert et al., 2002] Rpsl gene, B 5′-ACGCTTCTCTGCCTTATGGC-3′ Identification of Rev.1 (SNP11) 16M630F 442 5′-CCGGTATCAGCGGCG-3′ [Issa & Ashhab, 2016] 16M630R 5′-ACAAGATTGACGAATGTGGTC-3′ Rev630 F 682 5′-GTCATTCTTATGCCGGACT-3′ Rev630 R 5′-GAGATTGCGTTGAGAGGC-3′ MLVA-16 genotyping Locus name Repeat size (bp) Sequence 5′-> 3′ [Al Dahouk et al., 2007; Le Flèche et al., 2006] Panel I Bruce 06 F 134 5′-ATGGGATGTGGTA GGGTAATCG-3′ Bruce 06 R 5′- GCGTGACAATCGACTTTTTGTC -3′ Bruce 08 F 18 5′-ATTATTCGCAGGCTCGTGATTC-3′ Bruce 08 R 5′- ACAGAAGGTTTTCCAGCTCGTC -3′ Bruce 11 F 63 5′-CTGTTGATCTGACCTTGCAACC-3′ Bruce 11 R 5′- CCAGACAACAACCTACGTCCTG -3′ Bruce 12 F 15 5′-CGGTAAATCAATTGTCCCATGA-3′ Bruce 12 R 5′- GCCCAAGTTCAACAGGAGTTTC -3′ Bruce 42 F 125 5′-CATCGCCTCAACTATACCGTCA-3′ Bruce 42 R 5′- ACCGCAAAATTTACGCATCG -3′ Bruce 43 F 12 5′-TCTCAA GCCCGATATGGA GAAT-3′ Bruce 43 R 5′- TATTTTCCGCCTGCCCATAAAC -3′ Bruce 45 F 18 5′-ATCCTTGCCTCTCCCTACCAG-3′ Bruce 45 R 5′- CGGGTAAATATCAATGGCTTGG -3′ Bruce 55 F 40 5′-TCA GGCTGTTTCGTCATGTCTT-3′ Bruce 55 R 5′- AATCTGGCGTTCGAGTTGTTCT -3′ Panel IIA Bruce 18 F 8 5′-TATGTTAGGGCAATA GGGCAGT-3′ Bruce 18 R 5′-GATGGTTGAGAGCATTGTGAAG-3′ Bruce 19 F 8 5′-GACGACCCGGACCATGTCT-3′ Bruce 19 R 5′-ACTTCACCGTAACGTCGTGGAT-3′ Bruce 21 F 8 5′-CTCATGCGCAACCAAAACA-3′ Bruce 21 R 5′-GATCTCGTGGTCGATAATCTCATT-3′ Panel IIB Bruce 04 F 8 5′-CTGACGAAGGGAAGGCAATAAG-3′ Bruce 04 R 5′-CGATCTGGAGATTATCGGGAAG-3′ Bruce 07 F 8 5′-GCTGACGGGGAAGAACATCTAT-3′ Bruce 07 R 5′-ACCCTTTTTCAGTCAAGGCAAA-3′ Bruce 09 F 8 5′-GCGGATTCGTTCTTCAGTTATC-3′ Bruce 09 R 5′-GGGAGTATGTTTTGGTTGTACATAG-3′ Bruce 16 F 8 5′-ACGGGAGTTTTTGTTGCTCAAT-3′ Bruce 16 R 5′-GGCCATGTTTCCGTTGATTTAT-3′ Bruce 30 F 8 5′-TGACCGCAAAACCATATCCTTC-3′ Bruce 30 R 5′-TATGTGCAGAGCTTCATGTTCG-3′ REFERENCE Aljanazreh, B., Alzatari, K., Tamimi, A., Alsaafeen, M. H., Hassouneh, W., & Ashhab, Y. (2022). Brucellosis re-emergence after a decade of quiescence in Palestin, 2015–2017: A seroprevalence and molecular characterization study. Transboundary and Emerging Diseases, 69(4), e130– e140. https://doi.org/10.1111/tbed.14270 Wiley Online LibraryCASPubMedWeb of Science®Google Scholar Early ViewOnline Version of Record before inclusion in an issue ReferencesRelatedInformation" @default.
• W4294631412 created "2022-09-05" @default.
• W4294631412 date "2022-09-14" @default.
• W4294631412 modified "2023-09-24" @default.
• W4294631412 title " " @default.
• W4294631412 cites W3137527562 @default.
• W4294631412 doi "https://doi.org/10.1111/tbed.14690" @default.
• W4294631412 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/36063426" @default.
• W4294631412 hasPublicationYear "2022" @default.
• W4294631412 type Work @default.
• W4294631412 citedByCount "0" @default.
• W4294631412 crossrefType "journal-article" @default.
• W4294631412 hasConcept C116834253 @default.
• W4294631412 hasConcept C161191863 @default.
• W4294631412 hasConcept C23123220 @default.
• W4294631412 hasConcept C2778805511 @default.
• W4294631412 hasConcept C41008148 @default.
• W4294631412 hasConcept C59822182 @default.
• W4294631412 hasConcept C86803240 @default.
• W4294631412 hasConceptScore W4294631412C116834253 @default.
• W4294631412 hasConceptScore W4294631412C161191863 @default.
• W4294631412 hasConceptScore W4294631412C23123220 @default.
• W4294631412 hasConceptScore W4294631412C2778805511 @default.
• W4294631412 hasConceptScore W4294631412C41008148 @default.
• W4294631412 hasConceptScore W4294631412C59822182 @default.
• W4294631412 hasConceptScore W4294631412C86803240 @default.
• W4294631412 hasIssue "6" @default.
• W4294631412 hasLocation W42946314121 @default.
• W4294631412 hasLocation W42946314122 @default.
• W4294631412 hasOpenAccess W4294631412 @default.
• W4294631412 hasPrimaryLocation W42946314121 @default.
• W4294631412 hasRelatedWork W2086064646 @default.
• W4294631412 hasRelatedWork W2115485936 @default.
• W4294631412 hasRelatedWork W2119135658 @default.
• W4294631412 hasRelatedWork W2119214692 @default.
• W4294631412 hasRelatedWork W2153015554 @default.
• W4294631412 hasRelatedWork W2357241418 @default.
• W4294631412 hasRelatedWork W2366644548 @default.
• W4294631412 hasRelatedWork W2376314740 @default.
• W4294631412 hasRelatedWork W2384888906 @default.
• W4294631412 hasRelatedWork W1578520212 @default.
• W4294631412 hasVolume "69" @default.
• W4294631412 isParatext "false" @default.
• W4294631412 isRetracted "false" @default.
• W4294631412 workType "article" @default.