FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W4296981683> ?p ?o ?g. }

• W4296981683 endingPage "12448" @default.
• W4296981683 startingPage "12440" @default.
• W4296981683 abstract "We investigated whether peroxisome proliferator-activated receptor γ (PPARγ) ligands (ciglitazone, troglitazone, and 15-deoxy-Δ12,14prostaglandin J2) inhibited cyclooxygenase-2 (COX-2) induction in human epithelial cells. Ligands of PPARγ inhibited phorbol ester (phorbol 12-myristate 13-acetate, PMA)-mediated induction of COX-2 and prostaglandin E2 synthesis. Nuclear run-offs revealed increased rates of COX-2 transcription after treatment with PMA, an effect that was inhibited by PPARγ ligands. PMA-mediated induction of COX-2 promoter activity was inhibited by PPARγ ligands; this suppressive effect was prevented by overexpressing a dominant negative form of PPARγ or a PPAR response element decoy oligonucleotide. The stimulatory effects of PMA were mediated by a cyclic AMP response element in the COX-2promoter. Treatment with PMA increased activator protein-1 (AP-1) activity and the binding of c-Jun, c-Fos, and ATF-2 to the cyclic AMP response element, effects that were blocked by PPARγ ligands. These findings raised questions about the mechanism underlying the anti-AP-1 effect of PPARγ ligands. The induction of c-Jun by PMA was blocked by PPARγ ligands. Overexpression of either c-Jun or CREB-binding protein/p300 partially relieved the suppressive effect of PPARγ ligands. When CREB-binding protein and c-Jun were overexpressed together, the ability of PPARγ ligands to suppress PMA-mediated induction of COX-2 promoter activity was essentially abrogated. Bisphenol A diglycidyl ether, a compound that binds to PPARγ but lacks the ability to activate transcription, also inhibited PMA-mediated induction of AP-1 activity and COX-2. Taken together, these findings are likely to be important for understanding the anti-inflammatory and anti-cancer properties of PPARγ ligands. We investigated whether peroxisome proliferator-activated receptor γ (PPARγ) ligands (ciglitazone, troglitazone, and 15-deoxy-Δ12,14prostaglandin J2) inhibited cyclooxygenase-2 (COX-2) induction in human epithelial cells. Ligands of PPARγ inhibited phorbol ester (phorbol 12-myristate 13-acetate, PMA)-mediated induction of COX-2 and prostaglandin E2 synthesis. Nuclear run-offs revealed increased rates of COX-2 transcription after treatment with PMA, an effect that was inhibited by PPARγ ligands. PMA-mediated induction of COX-2 promoter activity was inhibited by PPARγ ligands; this suppressive effect was prevented by overexpressing a dominant negative form of PPARγ or a PPAR response element decoy oligonucleotide. The stimulatory effects of PMA were mediated by a cyclic AMP response element in the COX-2promoter. Treatment with PMA increased activator protein-1 (AP-1) activity and the binding of c-Jun, c-Fos, and ATF-2 to the cyclic AMP response element, effects that were blocked by PPARγ ligands. These findings raised questions about the mechanism underlying the anti-AP-1 effect of PPARγ ligands. The induction of c-Jun by PMA was blocked by PPARγ ligands. Overexpression of either c-Jun or CREB-binding protein/p300 partially relieved the suppressive effect of PPARγ ligands. When CREB-binding protein and c-Jun were overexpressed together, the ability of PPARγ ligands to suppress PMA-mediated induction of COX-2 promoter activity was essentially abrogated. Bisphenol A diglycidyl ether, a compound that binds to PPARγ but lacks the ability to activate transcription, also inhibited PMA-mediated induction of AP-1 activity and COX-2. Taken together, these findings are likely to be important for understanding the anti-inflammatory and anti-cancer properties of PPARγ ligands. Withdrawal: Peroxisome proliferator-activated receptor γ ligands suppress the transcriptional activation of cyclooxygenase-2: Evidence for involvement of activator protein-1 and CREB-binding protein/p300.Journal of Biological ChemistryVol. 295Issue 1PreviewVOLUME 276 (2001) PAGES 12440–12448 Full-Text PDF Open Access COX1 catalyzes the synthesis of prostaglandins from arachidonic acid. There are two isoforms of COX. COX-1 is constitutively expressed in most tissues and appears to be responsible for various physiologic functions (1Smith W.L. Garavito R.M. DeWitt D.L. J. Biol. Chem. 1996; 271: 33157-33160Abstract Full Text Full Text PDF PubMed Scopus (1860) Google Scholar, 2Smith W.L. DeWitt D.L. Semin. Nephrol. 1995; 15: 179-194PubMed Google Scholar). COX-2 is an immediate, early response gene that is rapidly induced by phorbol esters, growth factors, cytokines, and oncogenes (3Kujubu D.A. Fletcher B.S. Varnum B.C. Lim R.W. Herschman H.R. J. Biol. Chem. 1991; 266: 12866-12872Abstract Full Text PDF PubMed Google Scholar, 4Jones D.A. Carlton D.P. McIntyre T.M. Zimmerman G.A. Prescott S.M. J. Biol. Chem. 1993; 268: 9049-9054Abstract Full Text PDF PubMed Google Scholar, 5DuBois R.N. Awad J. Morrow J. Roberts L.J. Bishop P.R. J. Clin. Invest. 1994; 93: 493-498Crossref PubMed Scopus (379) Google Scholar, 6Inoue H. Yokoyama C. Hara S. Tone Y. Tanabe T. J. Biol. Chem. 1995; 270: 24965-24971Abstract Full Text Full Text PDF PubMed Scopus (469) Google Scholar, 7Simmons D.L. Levy D.B. Yannoni Y. Erikson R.L. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 1178-1182Crossref PubMed Scopus (295) Google Scholar, 8Subbaramaiah K. Telang N. Ramonetti J.T. Araki R. DeVito B. Weksler B.B. Dannenberg A.J. Cancer Res. 1996; 56: 4424-4429PubMed Google Scholar, 9Mestre J.R. Subbaramaiah K. Sacks P.G. Schantz S.P. Tanabe T. Inoue H. Dannenberg A.J. Cancer Res. 1997; 57: 2890-2895PubMed Google Scholar). COX-2 is an important therapeutic target for preventing or treating arthritis and cancer (10Anderson G.D. Hauser S.D. McGarity K.L. Bremer M.E. Isakson P.C. Gregory S.A. J. Clin. Invest. 1996; 97: 2672-2679Crossref PubMed Scopus (538) Google Scholar, 11Lipsky P.E. Isakson P.C. J. Rheumatol. 1997; 24 Suppl. 49: 9-14Google Scholar, 12Dannenberg A.J. Zakim D. Semin. Oncol. 1999; 26: 499-504PubMed Google Scholar). Selective COX-2 inhibitors decrease inflammation and are widely used to treat arthritis (13Simon L.S. Weaver A.L. Graham D.Y. Kivitz A.J. Lipsky P.E. Hubbard R.C. Isakson P.C. Verburg K.M., Yu, S.S. Zhao W.W. Geis G.S. J. Am. Med. Assoc. 1999; 282: 1921-1928Crossref PubMed Scopus (822) Google Scholar). COX-2 is overexpressed in transformed cells (8Subbaramaiah K. Telang N. Ramonetti J.T. Araki R. DeVito B. Weksler B.B. Dannenberg A.J. Cancer Res. 1996; 56: 4424-4429PubMed Google Scholar, 14Kutchera W. Jones D.A. Matsunami N. Groden J. McIntyre T.M. Zimmerman G.A. White R.L. Prescott S.M. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 4816-4820Crossref PubMed Scopus (445) Google Scholar, 15Sheng G.G. Shao J. Sheng H. Hooton E.B. Isakson P.C. Morrow J.D. Coffey R.J. DuBois R.N. Beauchamp R.D. Gastroenterology. 1997; 113: 1883-1891Abstract Full Text PDF PubMed Scopus (180) Google Scholar) and in malignant tumors (16Kargman S.L. O'Neil G.P. Vickers P.J. Evans J.F. Mancini J.A. Jothy S. Cancer Res. 1995; 55: 2556-2559PubMed Google Scholar, 17Ristimaki A. Honkanen N. Jankala H. Sipponen P. Harkonen M. Cancer Res. 1997; 57: 1276-1280PubMed Google Scholar, 18Parett M.L. Harris R.E. Joarder F.S. Ross M.S. Clausen K.P. Robertson F.M. Int. J. Oncol. 1997; 10: 503-507PubMed Google Scholar, 19Chan G. Boyle J.O. Yang E.K. Zhang F. Sacks P.G. Shah J.P. Edelstein D. Soslow R.A. Koki A.T. Woerner B.M. Masferrer J.L. Dannenberg A.J. Cancer Res. 1999; 59: 991-994PubMed Google Scholar, 20Tucker O.N. Dannenberg A.J. Yang E.K. Zhang F. Teng L. Daly J.M. Soslow R.A. Masferrer J.L. Woerner B.M. Koki A.T. Fahey T.J. Cancer Res. 1999; 59: 987-990PubMed Google Scholar). COX-2 knockout mice are protected against both intestinal (21Oshima M. Dinchuk J.E. Kargman S.L. Oshima H. Hancock B. Kwong E. Trzaskos J.M. Evans J.F. Taketo M.M. Cell. 1996; 87: 803-809Abstract Full Text Full Text PDF PubMed Scopus (2286) Google Scholar) and skin tumors (22Tiano H. Chulada P. Spalding J. Lee C. Loftin C. Mahler J. Morham S. Langenbach R. Proc. Am. Assoc. Cancer Res. 1997; 38: 1727Google Scholar). Moreover, selective COX-2 inhibitors suppress the formation and growth of tumors in experimental animals (23Kawamori T. Rao C.V. Seibert K. Reddy B.S. Cancer Res. 1998; 58: 409-412PubMed Google Scholar, 24Fischer S.M. Lo H.-H. Gordon G.B. Seibert K. Kelloff G. Lubet R.A. Conti C.C. Mol. Carcinog. 1999; 25: 231-240Crossref PubMed Scopus (371) Google Scholar, 25Sheng H. Shao J. Kirkland S.C. Isakson P. Coffey R.J. Morrow J. Beauchamp R.D. DuBois R.N. J. Clin. Invest. 1997; 99: 2254-2259Crossref PubMed Scopus (699) Google Scholar, 26Sawaoka H. Kawano S. Tsuji S. Tsujii M. Gunawan E.S. Takei Y. Nagano K. Hori M. Am. J. Physiol. 1998; 274: G1061-G1067PubMed Google Scholar, 27Harris R.E. Alshafie G.A. Abou-Issa H. Seibert K. Cancer Res. 2000; 60: 2101-2103PubMed Google Scholar) and decrease the number of colorectal polyps in patients with familial adenomatous polyposis (28Steinbach G. Lynch P.M. Phillips R.K.S. Wallace M.H. Hawk E. Gordon G.B. Wakabayashi N. Saunders B. Shen Y. Fujimura T. Su L.K. Levin B. N. Engl. J. Med. 2000; 342: 1946-1952Crossref PubMed Scopus (2299) Google Scholar). Because targeted inhibition of COX-2 is a promising approach to treating inflammation and preventing cancer, it is important to elucidate the signaling mechanisms that regulate COX-2 expression. Peroxisome proliferator-activated receptor γ (PPARγ) is a member of a nuclear hormone receptor superfamily that can modulate gene expression upon ligand binding. When PPARγ is activated by ligand binding, it is able to heterodimerize with the retinoid X receptor and activate gene expression by binding to PPAR response elements (29Kerstein S. Desvergne B. Wahli W. Nature. 2000; 405: 421-424Crossref PubMed Scopus (1678) Google Scholar, 30Meade E.A. McIntyre T.M. Zimmerman G.A. Prescott S.M. J. Biol. Chem. 1999; 274: 8328-8334Abstract Full Text Full Text PDF PubMed Scopus (268) Google Scholar). PPARγ ligands can also block both AP-1 and NFκB-mediated gene expression (31Ricote M. Li A.C. Willson T.M. Kelly C.J. Glass C.K. Nature. 1998; 391: 79-82Crossref PubMed Scopus (3271) Google Scholar, 32Su C.G. Wen X. Bailey S.T. Jiang W. Rangwala S.M. Keilbaugh S.A. Flanigan A. Murthy S. Lazar M.A. Wu G. J. Clin. Invest. 1999; 104: 383-389Crossref PubMed Scopus (729) Google Scholar, 33Li M. Pascual G. Glass C.K. Mol. Cell. Biol. 2000; 20: 4699-4707Crossref PubMed Scopus (355) Google Scholar, 34Inoue H. Tanabe T. Umesono K. J. Biol. Chem. 2000; 275: 28028-28032Abstract Full Text Full Text PDF PubMed Scopus (273) Google Scholar). Ligand-mediated activation of PPARγ has been linked to glucose homeostasis (35Nolan J.J. Ludvik B. Beerdsen P. Joyce M. Olefsky J. N. Engl. J. Med. 1994; 331: 1188-1193Crossref PubMed Scopus (922) Google Scholar), cellular differentiation (36Tontonoz P. Singer S. Forman B.M. Sarraf P. Fletcher J.A. Fletcher C.D.M. Brun R.P. Mueller E. Altiok A. Oppenheim H. Evans R.M. Spiegelman B.M. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 237-241Crossref PubMed Scopus (619) Google Scholar, 37Mueller E. Sarraf P. Tontonoz P. Evans R.M. Martin K.J. Zhang M. Fletcher C. Singer S. Spiegelman B.M. Mol. Cell. 1998; 1: 465-470Abstract Full Text Full Text PDF PubMed Scopus (780) Google Scholar), apoptosis (38Bishop-Bailey D. Hla T. J. Biol. Chem. 1999; 274: 17042-17048Abstract Full Text Full Text PDF PubMed Scopus (407) Google Scholar, 39Chang T.-H. Szabo E. Cancer Res. 2000; 60: 1129-1138PubMed Google Scholar, 40Tsubouchi Y. Sano H. Kawahito Y. Mukai S. Yamada R. Kohno M. Inoue K. Hla T. Kondo M. Biochem. Biophys. Res. Commun. 2000; 270: 400-405Crossref PubMed Scopus (310) Google Scholar), and anti-inflammatory responses (31Ricote M. Li A.C. Willson T.M. Kelly C.J. Glass C.K. Nature. 1998; 391: 79-82Crossref PubMed Scopus (3271) Google Scholar, 32Su C.G. Wen X. Bailey S.T. Jiang W. Rangwala S.M. Keilbaugh S.A. Flanigan A. Murthy S. Lazar M.A. Wu G. J. Clin. Invest. 1999; 104: 383-389Crossref PubMed Scopus (729) Google Scholar, 41Kawahito Y. Kondo M. Tsubouchi Y. Hashiramoto A. Bishop-Bailey D. Inoue K.-I. Kohno M. Yamada R. Hla T. Sano H. J. Clin. Invest. 2000; 106: 189-197Crossref PubMed Scopus (368) Google Scholar). Currently, thiazolidinediones, a class of PPARγ ligands, are used to treat type II diabetes mellitus. Additionally, there is experimental evidence that PPARγ ligands possess both anti-inflammatory (31Ricote M. Li A.C. Willson T.M. Kelly C.J. Glass C.K. Nature. 1998; 391: 79-82Crossref PubMed Scopus (3271) Google Scholar, 32Su C.G. Wen X. Bailey S.T. Jiang W. Rangwala S.M. Keilbaugh S.A. Flanigan A. Murthy S. Lazar M.A. Wu G. J. Clin. Invest. 1999; 104: 383-389Crossref PubMed Scopus (729) Google Scholar,41Kawahito Y. Kondo M. Tsubouchi Y. Hashiramoto A. Bishop-Bailey D. Inoue K.-I. Kohno M. Yamada R. Hla T. Sano H. J. Clin. Invest. 2000; 106: 189-197Crossref PubMed Scopus (368) Google Scholar) and anti-neoplastic properties (36Tontonoz P. Singer S. Forman B.M. Sarraf P. Fletcher J.A. Fletcher C.D.M. Brun R.P. Mueller E. Altiok A. Oppenheim H. Evans R.M. Spiegelman B.M. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 237-241Crossref PubMed Scopus (619) Google Scholar, 37Mueller E. Sarraf P. Tontonoz P. Evans R.M. Martin K.J. Zhang M. Fletcher C. Singer S. Spiegelman B.M. Mol. Cell. 1998; 1: 465-470Abstract Full Text Full Text PDF PubMed Scopus (780) Google Scholar, 38Bishop-Bailey D. Hla T. J. Biol. Chem. 1999; 274: 17042-17048Abstract Full Text Full Text PDF PubMed Scopus (407) Google Scholar, 39Chang T.-H. Szabo E. Cancer Res. 2000; 60: 1129-1138PubMed Google Scholar, 42Xin X. Yang S. Kowalski J. Gerritsen M.E. J. Biol. Chem. 1999; 274: 9116-9121Abstract Full Text Full Text PDF PubMed Scopus (479) Google Scholar, 43Brockman J.A. Gupta R.A. Gupta R.N. Gastroenterology. 1998; 115: 1049-1055Abstract Full Text Full Text PDF PubMed Scopus (304) Google Scholar, 44Kubota T. Koshizuka K. Williamson E.A. Asou H. Said J.W. Holden S. Miyoshi I. Koeffler H.P. Cancer Res. 1998; 58: 3344-3352PubMed Google Scholar, 45Demetri G.D. Fletcher C.D.M. Mueller E. Sarraf P. Naujoks R. Campbell N. Spiegelman B.M. Singer S. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 3951-3956Crossref PubMed Scopus (466) Google Scholar, 46Suh N. Wang Y. Williams C.R. Risingsong R. Gilmer T. Willson T.M. Sporn M.B. Cancer Res. 1999; 59: 5671-5673PubMed Google Scholar). The precise mechanisms underlying these effects of PPARγ ligands are unknown. In the current study, we show that PPARγ ligands inhibited AP-1-mediated transcriptional activation of COX-2 in human epithelial cells. The anti-AP-1 activity of PPARγ ligands was a consequence of inhibition of c-Jun expression and competition for limiting amounts of the general coactivator CREB-binding protein (CBP). These results may help to explain the ability of PPARγ ligands to suppress carcinogenesis and arthritis. Minimal essential medium, Opti-MEM, and LipofectAMINE were from Life Technologies, Inc. Keratinocyte basal and growth media were from Clonetics Corp. (San Diego, CA). Phorbol 12-myristate 13-acetate, taxol, sphingomyelinase, sodium arachidonate, 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (thiazolyl blue), lactate dehydrogenase diagnostic kits, epinephrine, epidermal growth factor, hydrocortisone, poly(dI·dC), ando-nitrophenyl-β-d-galactopyranoside were from Sigma. Ciglitazone and 15-deoxy-Δ12,14 prostaglandin J2 (15d-PGJ2) were from Biomol Research Labs Inc. (Plymouth Meeting, PA). Troglitazone and its M metabolite were generously provided by Dr. A. Saltiel (Parke-Davis). Bisphenol A diglycidyl ether (BADGE) was obtained from Fluka (Milwaukee, WI). Enzyme immunoassay reagents for PGE2 assays were from Cayman Co. (Ann Arbor, MI). Western blotting detection reagents, [32P]ATP, [32P]CTP, and [32P]UTP were from PerkinElmer Life Sciences. Random priming kits were from Roche Molecular Biochemicals. Nitrocellulose membranes were from Schleicher & Schuell. Reagents for the luciferase assay were from PharMingen (San Diego, CA). The 18 S rRNA cDNA was from Ambion, Inc. (Austin, TX). T4 polynucleotide kinase was from New England Biolabs (Beverly, MA). Antisera to PPARγ, COX-2, c-Jun, c-Fos, and ATF-2 were purchased from Santa Cruz Biotechnology, Inc. (San Diego). Plasmid DNA was prepared using a kit from Promega Corp.(Madison, WI). Oligonucleotides were synthesized by Genosys (The Woodlands, TX). The 184B5/HER and 184B5 cell lines have been described previously (47Zhai Y.-F. Beittenmiller H. Wang B. Gould M.N. Oakley C. Esselman W.J. Welsch C.W. Cancer Res. 1993; 53: 2272-2278PubMed Google Scholar). Cells were maintained in minimum essential medium/keratinocyte basal medium mixed in a ratio of 1:1 (basal medium) containing epidermal growth factor (10 ng/ml), hydrocortisone (0.5 μg/ml), transferrin (10 μg/ml), gentamicin (5 μg/ml), and insulin (10 μg/ml) (growth medium). Cells were grown to 60% confluence, trypsinized with 0.05% trypsin, 2 mm EDTA, and plated for experimental use. MSK Leuk1 cells have been described previously (48Sacks P.G. Cancer Metastasis Rev. 1996; 15: 27-51Crossref PubMed Scopus (105) Google Scholar). Cells were routinely maintained in keratinocyte growth medium and passaged using 0.125% trypsin, 2 mm EDTA. In all experiments, 184B5/HER and MSK Leuk1 cells were grown in basal medium for 24 h prior to treatment. Treatment with vehicle (0.2% Me2SO), PPARγ ligands, or PMA was always carried out in basal medium. Cellular cytotoxicity was assessed by measurements of cell number, release of lactate dehydrogenase, and the 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide assay, which was performed according to the method of Denizot and Lang (49Denizot F. Lang R. J. Immunol. Methods. 1986; 89: 271-277Crossref PubMed Scopus (4357) Google Scholar). Lactate dehydrogenase assays were performed according to the manufacturer's instructions. There was no evidence of toxicity in any of our experiments. 5 × 104 cells/well were plated in 6-well dishes and grown to 60% confluence in growth medium. Levels of PGE2 released by the cells were measured by enzyme immunoassay. Production of PGE2 was normalized to protein concentrations. Cell lysates were prepared by treating cells with lysis buffer (150 mm NaCl, 100 mmTris (pH 8.0), 1% Tween 20, 50 mm diethyldithiocarbamate, 1 mm EDTA, 1 mm phenylmethylsulfonyl fluoride, 10 μg/ml aprotinin, 10 μg/ml trypsin inhibitor, and 10 μg/ml leupeptin). Lysates were sonicated for 20 s on ice and centrifuged at 10,000 × g for 10 min to sediment the particulate material. The protein concentration of the supernatant was measured by the method of Lowry et al. (50Lowry O.H. Rosebrough N.J. Farr A.L. Randell R.J. J. Biol. Chem. 1951; 193: 265-275Abstract Full Text PDF PubMed Google Scholar). SDS-polyacrylamide gel electrophoresis was performed under reducing conditions on 10% polyacrylamide gels as described by Laemmli (51Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (207537) Google Scholar). The resolved proteins were transferred onto nitrocellulose sheets as detailed by Towbinet al. (52Towbin H. Staehelin T. Gordon J. Proc. Natl. Acad. Sci. U. S. A. 1979; 76: 4350-4354Crossref PubMed Scopus (44939) Google Scholar). The nitrocellulose membrane was then incubated with primary antisera. Secondary antibody to IgG conjugated to horseradish peroxidase was used. The blots were probed with Renaissance Western blot detection system according to the manufacturer's instructions. Total cellular RNA was isolated from cell monolayers using an RNA isolation kit from Qiagen Inc. 10 μg of total cellular RNA per lane were electrophoresed in a formaldehyde-containing 1.2% agarose gel and transferred to nylon-supported membranes. After baking, membranes were prehybridized overnight in a solution containing 50% formamide, 5× sodium chloride/sodium phosphate/EDTA buffer (SSPE), 5× Denhardt's solution, 0.1% SDS, and 100 μg/ml single-stranded salmon sperm DNA and then hybridized for 12 h at 42 °C with radiolabeled cDNA probes for human COX-2 and 18 S rRNA. COX-2 and 18 S rRNA probes were labeled with [32P]CTP by random priming. After hybridization, membranes were washed twice for 20 min at room temperature in 2× SSPE, 0.1% SDS, twice for 20 min in the same solution at 55 °C, and twice for 20 min in 0.1 × SSPE, 0.1% SDS at 55 °C. Washed membranes were then subjected to autoradiography. 2.5 × 105 cells were plated in four T150 dishes for each condition. Cells were grown in growth medium until ∼60% confluent. Nuclei were isolated and stored in liquid nitrogen. For the transcription assay, nuclei (1.0 × 107) were thawed and incubated in reaction buffer (10 mm Tris (pH 8), 5 mm MgCl2, and 0.3m KCl) containing 100 μCi of uridine 5′-[32P]triphosphate and 1 mm unlabeled nucleotides. After 30 min, labeled nascent RNA transcripts were isolated. The human COX-2 and 18 S rRNA cDNAs were immobilized onto nitrocellulose and prehybridized overnight in hybridization buffer. Hybridization was carried out at 42 °C for 24 h using equal cpm/ml of labeled nascent RNA transcripts for each treatment group. The membranes were washed twice with 2× SSC buffer for 1 h at 55 °C and then treated with 10 mg/ml RNase A in 2× SSC at 37 °C for 30 min, dried, and autoradiographed. The PPRE3-tk-luciferase construct was provided by Dr. Mitchell Lazar (University of Pennsylvania, Philadelphia). The dominant negative PPARγ expression vector was kindly provided by Dr. V. K. K. Chatterjee (University of Cambridge, Cambridge, UK) (53Gurnell M. Wentworth J.M. Agostini M. Adams M. Collingwood T.N. Provenzano C. Browne P.O. Rajanayagam O. Burris T.P. Schwabe J.W. Lazar M.A. Chatterjee V.K.K. J. Biol. Chem. 2000; 275: 5754-5759Abstract Full Text Full Text PDF PubMed Scopus (254) Google Scholar). The COX-2 promoter constructs (−1432/+59, −327/+59, −220/+59, −124/+59, −52/+59, KBM, ILM, CRM, and CRM-ILM) were a gift of Dr. Tadashi Tanabe (National Cardiovascular Center Research Institute, Osaka, Japan) (6Inoue H. Yokoyama C. Hara S. Tone Y. Tanabe T. J. Biol. Chem. 1995; 270: 24965-24971Abstract Full Text Full Text PDF PubMed Scopus (469) Google Scholar). The human COX-2 cDNA was generously provided by Dr. Stephen M. Prescott (University of Utah, Salt Lake City, UT). RSV-c-Jun was a gift from Dr. Tom Curran (Roche Molecular Biochemicals). The AP-1 reporter plasmid (2xTRE-luciferase), composed of two copies of the consensus TRE ligated to luciferase, was kindly provided by Dr. Joan Heller Brown (University of California, La Jolla). P300/CBP expression vector was obtained from Dr. Robert Weinberg (Massachusetts Institute of Technology, Cambridge). The expression vector for CREB was kindly provided by Dr. James Leonard (Strang Cancer Prevention Center, New York). The expression vector for CEBPα was a gift from Dr. Steven McKnight (University of Texas Southwestern Medical Center, Dallas). pSV-β-Galactosidase was obtained from Promega. The PPRE decoy, scrambled and missense oligonucleotide sequences were as follows: PPRE decoy (ACTTGATCCCGTTTCAACTC), scrambled (TTAGGGAATCAGCAAGAGGT), and missense (ACTTGCGCCCGTTTCAACTC) (38Bishop-Bailey D. Hla T. J. Biol. Chem. 1999; 274: 17042-17048Abstract Full Text Full Text PDF PubMed Scopus (407) Google Scholar). In addition, the following oligonucleotides containing the CRE of the COX-2 promoter were synthesized: 5′-AAACAGTCATTTCGTCACATGGGCTTG-3′ (sense) and 5′-CAAGCCCATGTGACGAAATGACTGTTT-3′ (antisense). 184B5/HER cells were seeded at a density of 5 × 104 cells/well in 6-well dishes and grown to 50–60% confluence. For each well, 2 μg of plasmid DNA were introduced into cells using 8 μg of LipofectAMINE as per the manufacturer's instructions. After 7 h of incubation, the medium was replaced with basal medium. The activities of luciferase and β-galactosidase were measured in cellular extract as described previously (55Mestre J.R. Subbaramaiah K. Sacks P.G. Schantz S.P. Tanabe T. Inoue H. Dannenberg A.J. Cancer Res. 1997; 57: 1081-1085PubMed Google Scholar). Cells were harvested, and nuclear extracts were prepared. For binding studies, an oligonucleotide containing the CRE of the COX-2 promoter was used. The complementary oligonucleotides were annealed in 20 mm Tris (pH 7.6), 50 mm NaCl, 10 mmMgCl2, and 1 mm dithiothreitol. The annealed oligonucleotide was phosphorylated at the 5′-end with [γ-32P]ATP and T4 polynucleotide kinase. The binding reaction was performed by incubating 5 μg of nuclear protein in 20 mm HEPES (pH 7.9), 10% glycerol, 300 μg of bovine serum albumin, and 1 μg of poly(dI·dC) in a final volume of 10 μl for 10 min at 25 °C. The labeled oligonucleotide was added to the reaction mixture and allowed to incubate for an additional 20 min at 25 °C. The samples were electrophoresed on a 4% nondenaturing polyacrylamide gel. The gel was then dried and subjected to autoradiography at −80 °C. Comparisons between groups were made with the Student's t test. A difference between groups ofp < 0.05 was considered significant. We determined the expression of PPARγ in human breast and oral epithelial cells. Western blotting analysis revealed that PPARγ was expressed in 184B5, 184B5/HER (Fig.1 A), and premalignant oral epithelial cells (data not shown). The receptor was also detected in human breast cancer (Fig. 1 B). To investigate if the PPARγ receptor expressed in cell lines was transcriptionally active, 184B5/HER and MSK Leuk1 cells were transfected with a PPAR response element cloned upstream of luciferase (PPRE3-tk-luciferase). Treatment of 184B5/HER (Fig. 1 C) or MSK Leuk1 cells (data not shown) with PPARγ ligands (ciglitazone, 15d-PGJ2) caused a dose-dependent increase in promoter activity. Similar effects were observed with troglitazone. The possibility that PPARγ ligands inhibited PMA-mediated induction of PGE2 synthesis was investigated. Treatment of 184B5/HER cells with PMA led to a severalfold increase in PGE2production. This effect was suppressed by PPARγ ligands in a dose-dependent manner (Fig.2). PPARγ ligands also inhibited PMA-mediated induction of PGE2 synthesis in MSK Leuk1 cells (data not shown). To determine whether the above effects on production of PGE2 could be related to differences in amounts of COX-2, Western blotting of cell lysate protein was carried out. PMA induced COX-2 protein (Fig. 3,A–D and G). Treatment with PPARγ ligands (ciglitazone, Fig. 3 A; 15d-PGJ2, Fig.3 B; troglitazone, Fig. 3, C and G) caused a dose-dependent decrease in PMA-mediated induction of COX-2. In contrast, the M metabolite of troglitazone, a compound that cannot transactivate PPARγ, did not block the induction of COX-2 by PMA (Fig. 3 D). In addition to PMA, sphingomyelinase and taxol are known to induce COX-2 (56Subbaramaiah K. Chung W.J. Dannenberg A.J. J. Biol. Chem. 1998; 273: 32943-32949Abstract Full Text Full Text PDF PubMed Scopus (198) Google Scholar, 57Subbaramaiah K. Hart J.C. Norton L. Dannenberg A.J. J. Biol. Chem. 2000; 275: 14838-14845Abstract Full Text Full Text PDF PubMed Scopus (294) Google Scholar). Hence, we also determined whether PPARγ ligands could suppress sphingomyelinase- and taxol-mediated induction of COX-2. Ciglitazone caused dose-dependent suppression of the induction of COX-2 by sphingomyelinase (Fig. 3 E) and taxol (Fig.3 F).Figure 3COX-2 induction is blocked by PPAR γ ligands. 184B5/HER cells (A–F) and MSK Leuk1 cells (G) were treated for 4.5 h. Cellular lysate protein (25 μg/lane) was loaded onto a 10% SDS-polyacrylamide gel, electrophoresed, and subsequently transferred onto nitrocellulose. Immunoblots were probed with antibody specific for COX-2. A, lysate protein was from cells treated with vehicle (lane 2), PMA (50 ng/ml, lane 3), or PMA and ciglitazone (10, 15, 20, 25, 30 μm; lanes 4–8, respectively). B, lysate protein was from cells treated with vehicle (lane 2), PMA (50 ng/ml, lane 3), or PMA and 15d-PGJ2 (10, 15, 20, 25, and 30 μm; lanes 4–8, respectively). C,lysate protein was from cells treated with vehicle (lane 2), PMA (50 ng/ml, lane 3), or PMA and troglitazone (25, 50 μm; lanes 4 and 5, respectively).D, lysate protein was from cells treated with vehicle (lane 2), PMA (50 ng/ml, lane 3), or PMA and the M metabolite of troglitazone (25, 50 μm; lanes 4 and 5, respectively). E, lysate protein was from cells treated with vehicle (lane 2), sphingomyelinase (10 milliunits/ml, lane 3), or sphingomyelinase and ciglitazone (10, 20, 30 μm;lanes 4–6, respectively). F, lysate protein was from cells treated with vehicle (lane 2), taxol (10 μm, lane 3), or taxol and ciglitazone (15, 20, 25, 30 μm; lanes 4–7, respectively).G, MSK Leuk1 cells were treated with vehicle (lane 2), PMA (50 ng/ml, lane 3), or PMA and troglitazone (12.5, 15, 17.5, 20 μm; lanes 4–7, respectively). In A–G, lane 1, represents a COX-2 standard.View Large Image Figure ViewerDownload Hi-res image Download (PPT) To elucidate further the mechanism responsible for the changes in amounts of COX-2 protein, we determined steady state levels of COX-2 mRNA by Northern blotting. As shown in Fig.4, A and B, treatment with PMA enhanced levels of COX-2 mRNA, an effect that was suppressed by ciglitazone or troglitazone in a concentration-dependent manner. Comparable effects were observed with 15d-PGJ2 (data not shown). Nuclear run-off assays were performed to determine whether differences in amounts of COX-2 mRNA reflected altered rates of transcription. We detected a marked increase in rates of synthesis of nascent COX-2 mRNA after treatment with PMA consistent with the differences observed by Northern blotting (Fig. 4 C). This effect was suppressed by ciglitazone (Fig. 4 C) and 15d-PGJ2 (data not shown). Transient transfections were performed to elucidate further the effects of PMA and PPARγ ligands on COX-2 transcription. PMA stimulated COX-2 promoter ac" @default.
• W4296981683 created "2022-09-25" @default.
• W4296981683 creator A5013077524 @default.
• W4296981683 creator A5023194667 @default.
• W4296981683 creator A5024031906 @default.
• W4296981683 creator A5056370132 @default.
• W4296981683 date "2001-04-01" @default.
• W4296981683 modified "2023-10-12" @default.
• W4296981683 title "Peroxisome Proliferator-activated Receptor γ Ligands Suppress the Transcriptional Activation of Cyclooxygenase-2" @default.
• W4296981683 cites W1485442945 @default.
• W4296981683 cites W1494611500 @default.
• W4296981683 cites W1544157645 @default.
• W4296981683 cites W1629179716 @default.
• W4296981683 cites W1633340712 @default.
• W4296981683 cites W1647126819 @default.
• W4296981683 cites W1775749144 @default.
• W4296981683 cites W1966861485 @default.
• W4296981683 cites W1968444137 @default.
• W4296981683 cites W1970474244 @default.
• W4296981683 cites W1974822812 @default.
• W4296981683 cites W1975160900 @default.
• W4296981683 cites W1980811942 @default.
• W4296981683 cites W1989969820 @default.
• W4296981683 cites W1990747124 @default.
• W4296981683 cites W1991179596 @default.
• W4296981683 cites W1991996819 @default.
• W4296981683 cites W1993342645 @default.
• W4296981683 cites W1994489610 @default.
• W4296981683 cites W1997208118 @default.
• W4296981683 cites W2002992087 @default.
• W4296981683 cites W2003115027 @default.
• W4296981683 cites W2003537519 @default.
• W4296981683 cites W2006340844 @default.
• W4296981683 cites W2013687281 @default.
• W4296981683 cites W2020061207 @default.
• W4296981683 cites W2029303498 @default.
• W4296981683 cites W2032615620 @default.
• W4296981683 cites W2041996406 @default.
• W4296981683 cites W2043707891 @default.
• W4296981683 cites W2046345325 @default.
• W4296981683 cites W2050352100 @default.
• W4296981683 cites W2051686420 @default.
• W4296981683 cites W2053242629 @default.
• W4296981683 cites W2075039358 @default.
• W4296981683 cites W2082728629 @default.
• W4296981683 cites W2087908472 @default.
• W4296981683 cites W2088263896 @default.
• W4296981683 cites W2088534912 @default.
• W4296981683 cites W2092171701 @default.
• W4296981683 cites W2100837269 @default.
• W4296981683 cites W2101108802 @default.
• W4296981683 cites W2107833029 @default.
• W4296981683 cites W2108345134 @default.
• W4296981683 cites W2124371647 @default.
• W4296981683 cites W2127558096 @default.
• W4296981683 cites W2133941138 @default.
• W4296981683 cites W2136385901 @default.
• W4296981683 cites W2143241514 @default.
• W4296981683 cites W2152653242 @default.
• W4296981683 cites W2156470937 @default.
• W4296981683 cites W2159973565 @default.
• W4296981683 cites W2164290354 @default.
• W4296981683 cites W2335922553 @default.
• W4296981683 cites W2336169581 @default.
• W4296981683 doi "https://doi.org/10.1074/jbc.m007237200" @default.
• W4296981683 hasPublicationYear "2001" @default.
• W4296981683 type Work @default.
• W4296981683 citedByCount "217" @default.
• W4296981683 countsByYear W42969816832012 @default.
• W4296981683 countsByYear W42969816832013 @default.
• W4296981683 countsByYear W42969816832014 @default.
• W4296981683 countsByYear W42969816832015 @default.
• W4296981683 countsByYear W42969816832016 @default.
• W4296981683 countsByYear W42969816832017 @default.
• W4296981683 countsByYear W42969816832018 @default.
• W4296981683 countsByYear W42969816832019 @default.
• W4296981683 countsByYear W42969816832020 @default.
• W4296981683 countsByYear W42969816832022 @default.
• W4296981683 crossrefType "journal-article" @default.
• W4296981683 hasAuthorship W4296981683A5013077524 @default.
• W4296981683 hasAuthorship W4296981683A5023194667 @default.
• W4296981683 hasAuthorship W4296981683A5024031906 @default.
• W4296981683 hasAuthorship W4296981683A5056370132 @default.
• W4296981683 hasBestOaLocation W42969816831 @default.
• W4296981683 hasConcept C127078168 @default.
• W4296981683 hasConcept C130241916 @default.
• W4296981683 hasConcept C170493617 @default.
• W4296981683 hasConcept C181199279 @default.
• W4296981683 hasConcept C185592680 @default.
• W4296981683 hasConcept C187345961 @default.
• W4296981683 hasConcept C2779689624 @default.
• W4296981683 hasConcept C2910266098 @default.
• W4296981683 hasConcept C55493867 @default.
• W4296981683 hasConcept C86803240 @default.
• W4296981683 hasConcept C95444343 @default.
• W4296981683 hasConcept C98274493 @default.
• W4296981683 hasConceptScore W4296981683C127078168 @default.
• W4296981683 hasConceptScore W4296981683C130241916 @default.

• next