Matches in SemOpenAlex for { <https://semopenalex.org/work/W4313331815> ?p ?o ?g. }
Showing items 1 to 59 of
59
with 100 items per page.
- W4313331815 abstract "Polymerase chain reaction (PCR) was conducted for the detection of MecA gene from the Staphylococcus aureus Isolated from both healthcare workers and burns and wound patients using the primers listed in table 3.1. A total PCR reaction volume of 25µl containing primers 2 µl, Pre-mix 15 µl, sample 2 µl, and water 6 µl was used, and a cycling condition, with Initial denaturation at 94 ºC for 5 min, and 30 cycles of denaturation at 94 ºC for 30 sec, annealing at 55 ºC for 30 sec and elongation at 72 ºC for 1 min and final extension 72 ºC 10 min was adopted. PCR amplification was conducted in a thermal cycler (MyCycler Thermal Cycler, Bio-Rad, Portugal) after which agarose gel electrophoresis was run to detect the presence (Band size) or absence of MecA gene as described by Poulsen et al., 2003 MecA gene primers Gene Primers (3’-5’ Amplicon Size (BP) mecA F: GGGATCATAGCGTCATTATTC R: AACGATTGTGACACGATAGCC 527" @default.
- W4313331815 created "2023-01-06" @default.
- W4313331815 creator A5024297525 @default.
- W4313331815 date "2022-12-29" @default.
- W4313331815 modified "2023-09-30" @default.
- W4313331815 title "MecA detection Protocol v1" @default.
- W4313331815 doi "https://doi.org/10.17504/protocols.io.dm6gpjdy1gzp/v1" @default.
- W4313331815 hasPublicationYear "2022" @default.
- W4313331815 type Work @default.
- W4313331815 citedByCount "0" @default.
- W4313331815 crossrefType "posted-content" @default.
- W4313331815 hasAuthorship W4313331815A5024297525 @default.
- W4313331815 hasBestOaLocation W43133318151 @default.
- W4313331815 hasConcept C104317684 @default.
- W4313331815 hasConcept C11701158 @default.
- W4313331815 hasConcept C153911025 @default.
- W4313331815 hasConcept C185592680 @default.
- W4313331815 hasConcept C2777052132 @default.
- W4313331815 hasConcept C2778271344 @default.
- W4313331815 hasConcept C2778476535 @default.
- W4313331815 hasConcept C2779489039 @default.
- W4313331815 hasConcept C43617362 @default.
- W4313331815 hasConcept C49105822 @default.
- W4313331815 hasConcept C523546767 @default.
- W4313331815 hasConcept C54355233 @default.
- W4313331815 hasConcept C55493867 @default.
- W4313331815 hasConcept C8185291 @default.
- W4313331815 hasConcept C86803240 @default.
- W4313331815 hasConceptScore W4313331815C104317684 @default.
- W4313331815 hasConceptScore W4313331815C11701158 @default.
- W4313331815 hasConceptScore W4313331815C153911025 @default.
- W4313331815 hasConceptScore W4313331815C185592680 @default.
- W4313331815 hasConceptScore W4313331815C2777052132 @default.
- W4313331815 hasConceptScore W4313331815C2778271344 @default.
- W4313331815 hasConceptScore W4313331815C2778476535 @default.
- W4313331815 hasConceptScore W4313331815C2779489039 @default.
- W4313331815 hasConceptScore W4313331815C43617362 @default.
- W4313331815 hasConceptScore W4313331815C49105822 @default.
- W4313331815 hasConceptScore W4313331815C523546767 @default.
- W4313331815 hasConceptScore W4313331815C54355233 @default.
- W4313331815 hasConceptScore W4313331815C55493867 @default.
- W4313331815 hasConceptScore W4313331815C8185291 @default.
- W4313331815 hasConceptScore W4313331815C86803240 @default.
- W4313331815 hasLocation W43133318151 @default.
- W4313331815 hasOpenAccess W4313331815 @default.
- W4313331815 hasPrimaryLocation W43133318151 @default.
- W4313331815 hasRelatedWork W1516475064 @default.
- W4313331815 hasRelatedWork W2004027931 @default.
- W4313331815 hasRelatedWork W2007289231 @default.
- W4313331815 hasRelatedWork W2032502643 @default.
- W4313331815 hasRelatedWork W2047106367 @default.
- W4313331815 hasRelatedWork W2055795193 @default.
- W4313331815 hasRelatedWork W2057741824 @default.
- W4313331815 hasRelatedWork W2380926176 @default.
- W4313331815 hasRelatedWork W3110803893 @default.
- W4313331815 hasRelatedWork W4255589087 @default.
- W4313331815 isParatext "false" @default.
- W4313331815 isRetracted "false" @default.
- W4313331815 workType "article" @default.