Matches in SemOpenAlex for { <https://semopenalex.org/work/W4313358637> ?p ?o ?g. }
Showing items 1 to 57 of
57
with 100 items per page.
- W4313358637 endingPage "15" @default.
- W4313358637 startingPage "12" @default.
- W4313358637 abstract "A study on genetic diversity analysis was conducted on Rusa timorensis obtained from state of Perak and state of Pahang to investigate the level of genetic diversity occur and to compare the diversity amongst two R. timorensis breeders in Malaysia. A total of six (n=6) individual samples of R. timorensis were extracted from Tanjung Malim, Perak and Bilut Agro Farm, Pahang and amplified using mitochondria deoxyribonucleic acid (mtDNA) primers gene as a target molecular marker. The mtDNA region was amplified using a set of cytochrome b gene primers (5”AAACCA GAAAAGGAGAGCAAC3”;5”TCATCTAGGCATTTTCAGTGCC3”) and nucleotide sequence of the mtDNA cyt b was aligned by using MEGA Ver 7.0. The result indicated that the R. timorensis from Pahang has a low degree of variation (0.252) of genetic distance compared to, R. timorensis from Perak (0.696). The phylogenetic three analysis, indicated, R. timorensis from Pahang resulted the highest intra-specific relationship at 100% compared to, R. timorensis from Perak at 63% of intra-specific relationship. The results showed that the genetic diversity of, R. timorensis in Perak and Pahang is likely to decrease in the future. Therefore, future breeding program plan needs to be implemented to diversify the genetics of genus Rusa in Malaysia." @default.
- W4313358637 created "2023-01-06" @default.
- W4313358637 creator A5039250071 @default.
- W4313358637 creator A5047959389 @default.
- W4313358637 date "2022-12-30" @default.
- W4313358637 modified "2023-10-01" @default.
- W4313358637 title "A preliminary investigation of genetic diversity amongst Rusa timorensis in Tanjung Malim, Perak and Bilut Agro Farm, Pahang, Malaysia" @default.
- W4313358637 doi "https://doi.org/10.47253/jtrss.v10i2.994" @default.
- W4313358637 hasPublicationYear "2022" @default.
- W4313358637 type Work @default.
- W4313358637 citedByCount "0" @default.
- W4313358637 crossrefType "journal-article" @default.
- W4313358637 hasAuthorship W4313358637A5039250071 @default.
- W4313358637 hasAuthorship W4313358637A5047959389 @default.
- W4313358637 hasBestOaLocation W43133586371 @default.
- W4313358637 hasConcept C104317684 @default.
- W4313358637 hasConcept C148292235 @default.
- W4313358637 hasConcept C193252679 @default.
- W4313358637 hasConcept C24586158 @default.
- W4313358637 hasConcept C2908647359 @default.
- W4313358637 hasConcept C54355233 @default.
- W4313358637 hasConcept C556039675 @default.
- W4313358637 hasConcept C71924100 @default.
- W4313358637 hasConcept C81977670 @default.
- W4313358637 hasConcept C86803240 @default.
- W4313358637 hasConcept C99454951 @default.
- W4313358637 hasConceptScore W4313358637C104317684 @default.
- W4313358637 hasConceptScore W4313358637C148292235 @default.
- W4313358637 hasConceptScore W4313358637C193252679 @default.
- W4313358637 hasConceptScore W4313358637C24586158 @default.
- W4313358637 hasConceptScore W4313358637C2908647359 @default.
- W4313358637 hasConceptScore W4313358637C54355233 @default.
- W4313358637 hasConceptScore W4313358637C556039675 @default.
- W4313358637 hasConceptScore W4313358637C71924100 @default.
- W4313358637 hasConceptScore W4313358637C81977670 @default.
- W4313358637 hasConceptScore W4313358637C86803240 @default.
- W4313358637 hasConceptScore W4313358637C99454951 @default.
- W4313358637 hasIssue "2" @default.
- W4313358637 hasLocation W43133586371 @default.
- W4313358637 hasOpenAccess W4313358637 @default.
- W4313358637 hasPrimaryLocation W43133586371 @default.
- W4313358637 hasRelatedWork W1605976158 @default.
- W4313358637 hasRelatedWork W1983278082 @default.
- W4313358637 hasRelatedWork W2092974338 @default.
- W4313358637 hasRelatedWork W2227994561 @default.
- W4313358637 hasRelatedWork W2315937907 @default.
- W4313358637 hasRelatedWork W2350230640 @default.
- W4313358637 hasRelatedWork W2351147051 @default.
- W4313358637 hasRelatedWork W2366552796 @default.
- W4313358637 hasRelatedWork W2616089404 @default.
- W4313358637 hasRelatedWork W4313470168 @default.
- W4313358637 hasVolume "10" @default.
- W4313358637 isParatext "false" @default.
- W4313358637 isRetracted "false" @default.
- W4313358637 workType "article" @default.