Matches in SemOpenAlex for { <https://semopenalex.org/work/W4367682244> ?p ?o ?g. }
Showing items 1 to 75 of
75
with 100 items per page.
- W4367682244 endingPage "33" @default.
- W4367682244 startingPage "22" @default.
- W4367682244 abstract "This study investigated the genetic relatedness and characterization of Nile tilapia (Oreochromis niloticus) populations from Lake Bako, Mambilla Plateau and Lake Alau, Maiduguri using Mitochondrial DNA (mtDNA) D-loop sequences. Blood samples were collected from each individual of and preserved on an FTA card. DNA was extracted from the card using Aqualex extraction kits. Polymerase Chain Reaction was performed using a commercially available decamer primer: FISH COMUM D-LOOP F (5’-GGATTYTAACCCYTRCCC -3’) and (R:) as the forward primer and C. zilli_rev (5′ – AGTAAAGTCAGGACCAAGCC – 3′) as reverse primer. The results showed that, in total 117 variable sites were observed and Hap_1_Hap_40 was detected. Lake Alau population has 65.50 % A+T and 34.5% G+C, while 65.5% and 34.9% were the nucleotide composition of Lake Bako population. Both populations have 1.00 Haplotypes diversity. The nucleotide diversity observed in Lake Bako population is 0.0342, while 0.0285 were recorded in Lake Bako population. The average number of nucleotide differences of 26.61053 and 31.98421 were observed in Lakes Bako and Alau populations, respectively with and overall value of 29.996. The Neighbour-Joining phylogenetic tree revealed two major clusters. The genetic variation among population is 95.31%and within population is 4.69%. Populations of O. niloticus in Lakes Bako and Alau are genetically different. Lake Bako population seemed to have intact genetic structure. Both populations have high genetic diversity, hence have high potential for genetic improvement and conservation." @default.
- W4367682244 created "2023-05-03" @default.
- W4367682244 creator A5049939703 @default.
- W4367682244 creator A5054952295 @default.
- W4367682244 creator A5055561208 @default.
- W4367682244 creator A5085828505 @default.
- W4367682244 date "2023-03-12" @default.
- W4367682244 modified "2023-10-06" @default.
- W4367682244 title "Mitochondrial DNA D-loop Genetic Relatedness and Characterization of Nile Tilapia (Oreochromis niloticus Linnaeus, 1758) from Lakes Alau and Bako, Northeast, Nigeria" @default.
- W4367682244 doi "https://doi.org/10.36108/jbt/3202.20.0120" @default.
- W4367682244 hasPublicationYear "2023" @default.
- W4367682244 type Work @default.
- W4367682244 citedByCount "0" @default.
- W4367682244 crossrefType "journal-article" @default.
- W4367682244 hasAuthorship W4367682244A5049939703 @default.
- W4367682244 hasAuthorship W4367682244A5054952295 @default.
- W4367682244 hasAuthorship W4367682244A5055561208 @default.
- W4367682244 hasAuthorship W4367682244A5085828505 @default.
- W4367682244 hasBestOaLocation W43676822441 @default.
- W4367682244 hasConcept C104317684 @default.
- W4367682244 hasConcept C135763542 @default.
- W4367682244 hasConcept C144024400 @default.
- W4367682244 hasConcept C149923435 @default.
- W4367682244 hasConcept C193252679 @default.
- W4367682244 hasConcept C197754878 @default.
- W4367682244 hasConcept C198268994 @default.
- W4367682244 hasConcept C24586158 @default.
- W4367682244 hasConcept C26589402 @default.
- W4367682244 hasConcept C2778658382 @default.
- W4367682244 hasConcept C2780129523 @default.
- W4367682244 hasConcept C2908647359 @default.
- W4367682244 hasConcept C2909208804 @default.
- W4367682244 hasConcept C505870484 @default.
- W4367682244 hasConcept C54355233 @default.
- W4367682244 hasConcept C81977670 @default.
- W4367682244 hasConcept C86803240 @default.
- W4367682244 hasConcept C90856448 @default.
- W4367682244 hasConceptScore W4367682244C104317684 @default.
- W4367682244 hasConceptScore W4367682244C135763542 @default.
- W4367682244 hasConceptScore W4367682244C144024400 @default.
- W4367682244 hasConceptScore W4367682244C149923435 @default.
- W4367682244 hasConceptScore W4367682244C193252679 @default.
- W4367682244 hasConceptScore W4367682244C197754878 @default.
- W4367682244 hasConceptScore W4367682244C198268994 @default.
- W4367682244 hasConceptScore W4367682244C24586158 @default.
- W4367682244 hasConceptScore W4367682244C26589402 @default.
- W4367682244 hasConceptScore W4367682244C2778658382 @default.
- W4367682244 hasConceptScore W4367682244C2780129523 @default.
- W4367682244 hasConceptScore W4367682244C2908647359 @default.
- W4367682244 hasConceptScore W4367682244C2909208804 @default.
- W4367682244 hasConceptScore W4367682244C505870484 @default.
- W4367682244 hasConceptScore W4367682244C54355233 @default.
- W4367682244 hasConceptScore W4367682244C81977670 @default.
- W4367682244 hasConceptScore W4367682244C86803240 @default.
- W4367682244 hasConceptScore W4367682244C90856448 @default.
- W4367682244 hasIssue "1" @default.
- W4367682244 hasLocation W43676822441 @default.
- W4367682244 hasOpenAccess W4367682244 @default.
- W4367682244 hasPrimaryLocation W43676822441 @default.
- W4367682244 hasRelatedWork W1838473581 @default.
- W4367682244 hasRelatedWork W2349809303 @default.
- W4367682244 hasRelatedWork W2355402230 @default.
- W4367682244 hasRelatedWork W2356932770 @default.
- W4367682244 hasRelatedWork W2360710012 @default.
- W4367682244 hasRelatedWork W2366552796 @default.
- W4367682244 hasRelatedWork W2372212165 @default.
- W4367682244 hasRelatedWork W2377805471 @default.
- W4367682244 hasRelatedWork W2392343515 @default.
- W4367682244 hasRelatedWork W75692005 @default.
- W4367682244 hasVolume "2" @default.
- W4367682244 isParatext "false" @default.
- W4367682244 isRetracted "false" @default.
- W4367682244 workType "article" @default.