FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W4385797997> ?p ?o ?g. }

• W4385797997 abstract "Pitaya (Selenicereus costaricensis), a tropical and subtropical fruit of Cactaceae family, become very popular in the fruit consumer market in recent years. In June 2022, plant stunting, reduced yields and galled root symptoms were observed on S. costaricensis plants sampled from a commercial production base in Wuming County (23°10′36.67″ N; 108°40′43.24″ E), Guangxi autonomous region, China. The area of S. costaricensis field we investigated was about 19.9 ha. The incidence of root-knot nematode disease was almost 60%. Roots of twenty S. costaricensis plants were dug up, and many root knots and egg masses were observed. The roots with galls were collected, nematodes at different stages were collected and morphologically identified. Females were annulated, pearly white and globular to pear-shaped. The perineal pattern was oval shaped with the dorsal arch being moderately high to high. Average length of adult females (n = 20): body = 614.4 ± 57.3 μm, stylet lengths = 15.1 ± 0.9 μm, dorsal esophageal gland orifice (DGO) = 4.7 ± 0.6 μm. The tail of the second stage juvenile (J2) was very thin with a bluntly pointed tip. The hyaline tail terminus was clearly defined. Average length of J2 (n = 20): body = 469.5 ± 36.7 μm, stylet lengths = 14.7 ± 0.5 μm, DGO = 3.5 ± 0.4 μm, tail lengths averaged = 43.6 ± 9.7 μm. The males were vermiform, annulated, slightly tapering anteriorly, bluntly rounded posteriorly. Typical characteristics of Meloidogyne enterolobii observed were consistent with those previously described by Yang & Eisenback (1983) and Bulletin (2016). J2s hatched from an individual egg mass were collected for DNA extraction and used for molecular biological identification. The specific primers of M. enterolobii, Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC), was used to validate the pathogen (Long et al. 2006). Approximately 236 bp of the target product was amplified, whereas no product was obtained from M. incognita. Further, the rDNA gene sequences (ITS; ITS1_5.8S_ITS2) and large subunit rDNA gene were amplified by the primers V5367/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al. 1992) and D2A/D3B (ACAAGTACCGTGAGGGAAAGT/TCGGAAGGAACCAGCTACTA), respectively (Subbotin et al. 2006). The target sequences of 765 bp (GenBank accession no. OQ512155) and 759 bp (OQ512743) were recorded in the NCBI with GeneBank. The sequences showed 100% identity with M. enterolobii in ITSs (KJ146863, JQ082448) and D2/D3 (MF467276, OL681885). To verify reproduction on S. costaricensis (Jindu 1), twelve ten-week-old seedlings (12 pots) cultured on a sterile substrate soil were inoculated with 5,000 J2s from the original population in a greenhouse at 26 ˚C. Noninoculated control were set up at the same time. After 8 weeks, the noninoculated plants (n = 12) did not present galls in the roots. All inoculated plants had galled roots and showed dwarf plant. The average reproductive factor obtained was 11.6 and the mean root gall rating of the samples was 5.3 (rating scale of 0 to 10), confirming the pathogenicity of M. enterolobii to S. costaricensis. The red dragon fruits (Hylocereus polyrhizus) in Hainan Island (China) were reported infected by M. enterolobii in previous report (Long et al. 2022). To our knowledge, this is the first report of M. enterolobii parasitizing S. costaricensis in Guangxi, China. This finding has important implications for the control of M. enterolobii at the place of discovery, which is the major fruit production area." @default.
• W4385797997 created "2023-08-15" @default.
• W4385797997 creator A5006829574 @default.
• W4385797997 creator A5015476236 @default.
• W4385797997 creator A5034565170 @default.
• W4385797997 creator A5043717775 @default.
• W4385797997 creator A5060766913 @default.
• W4385797997 creator A5079404098 @default.
• W4385797997 creator A5083275480 @default.
• W4385797997 date "2023-08-14" @default.
• W4385797997 modified "2023-10-13" @default.
• W4385797997 title "First Report of the guava root-knot nematode (Meloidogyne enterolobii) on Selenicereus costaricensis in Guangxi, China" @default.
• W4385797997 doi "https://doi.org/10.1094/pdis-04-23-0736-pdn" @default.
• W4385797997 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/37578359" @default.
• W4385797997 hasPublicationYear "2023" @default.
• W4385797997 type Work @default.
• W4385797997 citedByCount "0" @default.
• W4385797997 crossrefType "journal-article" @default.
• W4385797997 hasAuthorship W4385797997A5006829574 @default.
• W4385797997 hasAuthorship W4385797997A5015476236 @default.
• W4385797997 hasAuthorship W4385797997A5034565170 @default.
• W4385797997 hasAuthorship W4385797997A5043717775 @default.
• W4385797997 hasAuthorship W4385797997A5060766913 @default.
• W4385797997 hasAuthorship W4385797997A5079404098 @default.
• W4385797997 hasAuthorship W4385797997A5083275480 @default.
• W4385797997 hasConcept C105702510 @default.
• W4385797997 hasConcept C144027150 @default.
• W4385797997 hasConcept C151730666 @default.
• W4385797997 hasConcept C18903297 @default.
• W4385797997 hasConcept C2776207046 @default.
• W4385797997 hasConcept C2776364125 @default.
• W4385797997 hasConcept C2776410716 @default.
• W4385797997 hasConcept C2778830712 @default.
• W4385797997 hasConcept C2781345968 @default.
• W4385797997 hasConcept C59822182 @default.
• W4385797997 hasConcept C86803240 @default.
• W4385797997 hasConceptScore W4385797997C105702510 @default.
• W4385797997 hasConceptScore W4385797997C144027150 @default.
• W4385797997 hasConceptScore W4385797997C151730666 @default.
• W4385797997 hasConceptScore W4385797997C18903297 @default.
• W4385797997 hasConceptScore W4385797997C2776207046 @default.
• W4385797997 hasConceptScore W4385797997C2776364125 @default.
• W4385797997 hasConceptScore W4385797997C2776410716 @default.
• W4385797997 hasConceptScore W4385797997C2778830712 @default.
• W4385797997 hasConceptScore W4385797997C2781345968 @default.
• W4385797997 hasConceptScore W4385797997C59822182 @default.
• W4385797997 hasConceptScore W4385797997C86803240 @default.
• W4385797997 hasLocation W43857979971 @default.
• W4385797997 hasLocation W43857979972 @default.
• W4385797997 hasOpenAccess W4385797997 @default.
• W4385797997 hasPrimaryLocation W43857979971 @default.
• W4385797997 hasRelatedWork W1497924500 @default.
• W4385797997 hasRelatedWork W1543576939 @default.
• W4385797997 hasRelatedWork W2022863520 @default.
• W4385797997 hasRelatedWork W2037668096 @default.
• W4385797997 hasRelatedWork W2051445368 @default.
• W4385797997 hasRelatedWork W2073607434 @default.
• W4385797997 hasRelatedWork W2099852753 @default.
• W4385797997 hasRelatedWork W2126885781 @default.
• W4385797997 hasRelatedWork W2790478742 @default.
• W4385797997 hasRelatedWork W4248365408 @default.
• W4385797997 isParatext "false" @default.
• W4385797997 isRetracted "false" @default.
• W4385797997 workType "article" @default.