Matches in Ubergraph for { <http://purl.obolibrary.org/obo/ECO_0000202> ?p ?o ?g. }
Showing items 1 to 22 of
22
with 100 items per page.
- ECO_0000202 IAO_0000112 "A putative rho-independent terminator sequence (GCCTGACTACATAGATGTCAGGC) was identified at position 402-bp downstream of SMU.1882 by TransTerm (transterm.dev.java.net) program." @default.
- ECO_0000202 IAO_0000115 "A type of sequence similarity evidence in which the function of a gene product is predicted based on a sequence-based statistical model." @default.
- ECO_0000202 normalizedInformationContent "77.493725483418473" @default.
- ECO_0000202 referenceCount "30" @default.
- ECO_0000202 created_by "mchibucos" @default.
- ECO_0000202 creation_date "2010-03-18T12:32:30Z" @default.
- ECO_0000202 hasAlternativeId "ECO:00000063" @default.
- ECO_0000202 hasOBONamespace "eco" @default.
- ECO_0000202 id "ECO:0000202" @default.
- ECO_0000202 type Class @default.
- ECO_0000202 comment "Used when evidence from any kind of statistical model of a sequence or group of sequences is used to make a prediction about the function of a protein or RNA. Examples of relevant evidence are: Hidden Markov Models, PROSITE motifs, and tools such as tRNASCAN." @default.
- ECO_0000202 isDefinedBy eco.owl @default.
- ECO_0000202 label "match to sequence model evidence" @default.
- ECO_0000202 subClassOf ECO_0000000 @default.
- ECO_0000202 subClassOf ECO_0000041 @default.
- ECO_0000202 subClassOf ECO_0000044 @default.
- ECO_0000202 subClassOf ECO_0000202 @default.
- ECO_0000202 subClassOf ECO_0007672 @default.
- ECO_0000202 category Entity @default.
- ECO_0000202 category EvidenceType @default.
- ECO_0000202 category InformationContentEntity @default.
- ECO_0000202 category NamedThing @default.